\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324408073:

Variant ID: vg0324408073 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24408073
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGCGTCTGTCGGGTCGCATGGGCTCGAGTTTGCTCGCCCAAGGAGTATGGTGGTTTGGGGATTCCTGATCTAGAGAGGTTGGGAATCGCCCTGAGGTC[A/G]
CGATGGCTCTGGCAGCAGAGAACTTCACCGGAAAAGCCGTGGCAAGGGCTTAGTATTCCGGTCTCACAGAAGGAGCGCAATCTAGTATCGATTTCCATGG

Reverse complement sequence

CCATGGAAATCGATACTAGATTGCGCTCCTTCTGTGAGACCGGAATACTAAGCCCTTGCCACGGCTTTTCCGGTGAAGTTCTCTGCTGCCAGAGCCATCG[T/C]
GACCTCAGGGCGATTCCCAACCTCTCTAGATCAGGAATCCCCAAACCACCATACTCCTTGGGCGAGCAAACTCGAGCCCATGCGACCCGACAGACGCCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.00% 0.49% 0.57% NA
All Indica  2759 97.60% 1.60% 0.43% 0.33% NA
All Japonica  1512 0.70% 99.10% 0.13% 0.00% NA
Aus  269 83.60% 8.60% 1.49% 6.32% NA
Indica I  595 99.30% 0.20% 0.34% 0.17% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 98.40% 0.40% 0.55% 0.66% NA
Indica Intermediate  786 94.90% 4.30% 0.64% 0.13% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 43.30% 51.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324408073 A -> DEL LOC_Os03g43660.1 N frameshift_variant Average:41.166; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N
vg0324408073 A -> G LOC_Os03g43660.1 synonymous_variant ; p.Ser215Ser; LOW synonymous_codon Average:41.166; most accessible tissue: Zhenshan97 flower, score: 53.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324408073 NA 1.73E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.08E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.28E-65 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 8.04E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.19E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 3.92E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 2.22E-07 7.09E-93 mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 6.32E-130 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.61E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 4.93E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 5.30E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 4.54E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.53E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 6.87E-55 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 9.46E-80 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 8.81E-38 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 6.10E-124 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 1.93E-63 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 9.16E-171 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324408073 NA 2.77E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251