\
| Variant ID: vg0324328837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24328837 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 97. )
CAACAAGAGTTGTACATGGAACGACAAGGACTACTCGGATTGTATCCATATTGGCTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATA[C/T]
AAGGCCCCCTAAGAGGAGAGGGAACAATCAACACATTCCCACCATAGAAGATACGGAACAATAGATCAAGACAGAAGATTAACATAGAAGCCAATATACG
CGTATATTGGCTTCTATGTTAATCTTCTGTCTTGATCTATTGTTCCGTATCTTCTATGGTGGGAATGTGTTGATTGTTCCCTCTCCTCTTAGGGGGCCTT[G/A]
TATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAGCCAATATGGATACAATCCGAGTAGTCCTTGTCGTTCCATGTACAACTCTTGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 15.10% | 7.45% | 3.53% | NA |
| All Indica | 2759 | 62.60% | 25.20% | 11.78% | 0.43% | NA |
| All Japonica | 1512 | 98.40% | 0.40% | 0.20% | 0.99% | NA |
| Aus | 269 | 42.00% | 0.70% | 7.06% | 50.19% | NA |
| Indica I | 595 | 44.00% | 31.40% | 24.54% | 0.00% | NA |
| Indica II | 465 | 84.70% | 7.50% | 7.10% | 0.65% | NA |
| Indica III | 913 | 68.70% | 26.70% | 4.38% | 0.22% | NA |
| Indica Intermediate | 786 | 56.50% | 29.10% | 13.49% | 0.89% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 0.80% | 0.40% | 2.98% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 82.20% | 11.10% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324328837 | C -> T | LOC_Os03g43560.1 | downstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:38.933; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0324328837 | C -> T | LOC_Os03g43560-LOC_Os03g43564 | intergenic_region ; MODIFIER | silent_mutation | Average:38.933; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0324328837 | C -> DEL | N | N | silent_mutation | Average:38.933; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324328837 | 2.56E-06 | 1.12E-07 | mr1574 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324328837 | NA | 8.02E-06 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324328837 | NA | 8.12E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |