Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324228407:

Variant ID: vg0324228407 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24228407
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAGACCAATCTACACATAACTTCTTCTTAATTTTTAACTAAGCATTTCAAAAACTATTAATATAATTAAAATTATAAATATTTAACTAAATTTTATT[C/T]
GACAGCAAACATTAAATATTTATAATAAGAGAAAAAAATAATTAAAGTCAAGTAAATTGTTGAATACTCCCACCGTTTCAAAATGTTTGACACTGTTGAA

Reverse complement sequence

TTCAACAGTGTCAAACATTTTGAAACGGTGGGAGTATTCAACAATTTACTTGACTTTAATTATTTTTTTCTCTTATTATAAATATTTAATGTTTGCTGTC[G/A]
AATAAAATTTAGTTAAATATTTATAATTTTAATTATATTAATAGTTTTTGAAATGCTTAGTTAAAAATTAAGAAGAAGTTATGTGTAGATTGGTCTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	37.20%	8.36%	5.90%	NA
All Indica	2759	75.40%	1.30%	13.63%	9.64%	NA
All Japonica	1512	0.50%	98.70%	0.33%	0.46%	NA
Aus	269	63.90%	34.20%	1.49%	0.37%	NA
Indica I	595	66.90%	0.20%	24.87%	8.07%	NA
Indica II	465	65.40%	0.90%	18.49%	15.27%	NA
Indica III	913	85.50%	0.70%	4.71%	9.09%	NA
Indica Intermediate	786	76.00%	3.30%	12.60%	8.14%	NA
Temperate Japonica	767	0.10%	99.30%	0.26%	0.26%	NA
Tropical Japonica	504	0.60%	98.60%	0.20%	0.60%	NA
Japonica Intermediate	241	1.20%	97.10%	0.83%	0.83%	NA
VI/Aromatic	96	2.10%	96.90%	0.00%	1.04%	NA
Intermediate	90	34.40%	50.00%	11.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324228407	C -> T	LOC_Os03g43440.1	upstream_gene_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0324228407	C -> T	LOC_Os03g43440-LOC_Os03g43460	intergenic_region ; MODIFIER	silent_mutation	Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0324228407	C -> DEL	N	N	silent_mutation	Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324228407	NA	2.56E-67	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	5.24E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	1.57E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	2.20E-06	3.29E-94	mr1718	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	1.49E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	9.46E-121	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	6.71E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	2.12E-53	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	8.90E-40	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	1.35E-58	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	1.55E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	NA	3.10E-123	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407	2.25E-06	5.19E-161	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251