\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324228407:

Variant ID: vg0324228407 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24228407
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAGACCAATCTACACATAACTTCTTCTTAATTTTTAACTAAGCATTTCAAAAACTATTAATATAATTAAAATTATAAATATTTAACTAAATTTTATT[C/T]
GACAGCAAACATTAAATATTTATAATAAGAGAAAAAAATAATTAAAGTCAAGTAAATTGTTGAATACTCCCACCGTTTCAAAATGTTTGACACTGTTGAA

Reverse complement sequence

TTCAACAGTGTCAAACATTTTGAAACGGTGGGAGTATTCAACAATTTACTTGACTTTAATTATTTTTTTCTCTTATTATAAATATTTAATGTTTGCTGTC[G/A]
AATAAAATTTAGTTAAATATTTATAATTTTAATTATATTAATAGTTTTTGAAATGCTTAGTTAAAAATTAAGAAGAAGTTATGTGTAGATTGGTCTTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 37.20% 8.36% 5.90% NA
All Indica  2759 75.40% 1.30% 13.63% 9.64% NA
All Japonica  1512 0.50% 98.70% 0.33% 0.46% NA
Aus  269 63.90% 34.20% 1.49% 0.37% NA
Indica I  595 66.90% 0.20% 24.87% 8.07% NA
Indica II  465 65.40% 0.90% 18.49% 15.27% NA
Indica III  913 85.50% 0.70% 4.71% 9.09% NA
Indica Intermediate  786 76.00% 3.30% 12.60% 8.14% NA
Temperate Japonica  767 0.10% 99.30% 0.26% 0.26% NA
Tropical Japonica  504 0.60% 98.60% 0.20% 0.60% NA
Japonica Intermediate  241 1.20% 97.10% 0.83% 0.83% NA
VI/Aromatic  96 2.10% 96.90% 0.00% 1.04% NA
Intermediate  90 34.40% 50.00% 11.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324228407 C -> T LOC_Os03g43440.1 upstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0324228407 C -> T LOC_Os03g43440-LOC_Os03g43460 intergenic_region ; MODIFIER silent_mutation Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0324228407 C -> DEL N N silent_mutation Average:27.714; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324228407 NA 2.56E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 5.24E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 1.57E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 2.20E-06 3.29E-94 mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 1.49E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 9.46E-121 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 6.71E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 2.12E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 8.90E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 1.35E-58 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 1.55E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 NA 3.10E-123 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324228407 2.25E-06 5.19E-161 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251