\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324205491:

Variant ID: vg0324205491 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24205491
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAATTTAGGGACTGAGGTGGCACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTATAAGTTTAGGGATCGGAATGACACAGTCGAACAAGTTT[A/G]
AGGATATGAACGGTCGATTTGCGAGTTTAGGGACCAGGATGACACAGCGGTACAAGTTTAGAGACCGGTGATGGACTTTACTCTATATAGTTCTACCTTA

Reverse complement sequence

TAAGGTAGAACTATATAGAGTAAAGTCCATCACCGGTCTCTAAACTTGTACCGCTGTGTCATCCTGGTCCCTAAACTCGCAAATCGACCGTTCATATCCT[T/C]
AAACTTGTTCGACTGTGTCATTCCGATCCCTAAACTTATAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGCCACCTCAGTCCCTAAATTTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 37.40% 5.82% 2.96% NA
All Indica  2759 84.60% 2.00% 9.35% 4.06% NA
All Japonica  1512 0.70% 98.80% 0.33% 0.13% NA
Aus  269 58.70% 39.40% 1.49% 0.37% NA
Indica I  595 82.50% 0.30% 13.45% 3.70% NA
Indica II  465 74.60% 1.50% 16.99% 6.88% NA
Indica III  913 93.60% 1.40% 1.86% 3.07% NA
Indica Intermediate  786 81.70% 4.10% 10.43% 3.82% NA
Temperate Japonica  767 0.30% 99.50% 0.26% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.40% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 0.41% 0.83% NA
VI/Aromatic  96 3.10% 77.10% 0.00% 19.79% NA
Intermediate  90 38.90% 45.60% 8.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324205491 A -> DEL N N silent_mutation Average:32.996; most accessible tissue: Callus, score: 62.999 N N N N
vg0324205491 A -> G LOC_Os03g43400.1 upstream_gene_variant ; 3470.0bp to feature; MODIFIER silent_mutation Average:32.996; most accessible tissue: Callus, score: 62.999 N N N N
vg0324205491 A -> G LOC_Os03g43400-LOC_Os03g43410 intergenic_region ; MODIFIER silent_mutation Average:32.996; most accessible tissue: Callus, score: 62.999 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324205491 NA 1.63E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 2.91E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 2.37E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 5.72E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 3.31E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 2.57E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 5.31E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 4.27E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 3.61E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 6.48E-25 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 3.17E-06 7.08E-06 mr1396_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 2.42E-07 2.42E-07 mr1464_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 7.15E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 6.66E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 8.88E-06 mr1698_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205491 NA 1.36E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251