Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0323847195:

Variant ID: vg0323847195 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23847195
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACGTTTATTTTGTGTTAAAAAACCACTATATTTTTCTATAAATCTGGTCAAACTTAAAAAAAATTCGAGTAGAAAAAAAGTCAAATGATTTATAATAT[G/A]
AAACTGAGAGATCACTAATTATTTACGCATCAATTCGTCATTTCTTTTTATTGGTCGGTGAGGAAAAACTCGAGCATGTGAGCATATGCAAACAAAATTT

Reverse complement sequence

AAATTTTGTTTGCATATGCTCACATGCTCGAGTTTTTCCTCACCGACCAATAAAAAGAAATGACGAATTGATGCGTAAATAATTAGTGATCTCTCAGTTT[C/T]
ATATTATAAATCATTTGACTTTTTTTCTACTCGAATTTTTTTTAAGTTTGACCAGATTTATAGAAAAATATAGTGGTTTTTTAACACAAAATAAACGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	10.90%	0.80%	0.00%	NA
All Indica	2759	91.00%	9.00%	0.00%	0.00%	NA
All Japonica	1512	80.40%	17.30%	2.38%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.10%	25.90%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	90.10%	9.90%	0.00%	0.00%	NA
Temperate Japonica	767	63.10%	32.70%	4.17%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	94.60%	4.10%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323847195	G -> A	LOC_Os03g42810.1	upstream_gene_variant ; 2775.0bp to feature; MODIFIER	silent_mutation	Average:32.673; most accessible tissue: Callus, score: 60.354	N	N	N	N
vg0323847195	G -> A	LOC_Os03g42810.2	upstream_gene_variant ; 2775.0bp to feature; MODIFIER	silent_mutation	Average:32.673; most accessible tissue: Callus, score: 60.354	N	N	N	N
vg0323847195	G -> A	LOC_Os03g42799.1	downstream_gene_variant ; 2587.0bp to feature; MODIFIER	silent_mutation	Average:32.673; most accessible tissue: Callus, score: 60.354	N	N	N	N
vg0323847195	G -> A	LOC_Os03g42799-LOC_Os03g42810	intergenic_region ; MODIFIER	silent_mutation	Average:32.673; most accessible tissue: Callus, score: 60.354	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323847195	NA	5.13E-09	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323847195	NA	5.81E-06	mr1106	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	1.53E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	2.05E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	7.50E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	1.79E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	4.04E-06	mr1318	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	2.34E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	1.34E-07	1.34E-07	mr1597	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	2.87E-06	2.87E-06	mr1597	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	5.34E-06	6.83E-09	mr1788	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	9.70E-06	mr1816	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	7.05E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195	NA	6.39E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251