\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323847195:

Variant ID: vg0323847195 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23847195
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACGTTTATTTTGTGTTAAAAAACCACTATATTTTTCTATAAATCTGGTCAAACTTAAAAAAAATTCGAGTAGAAAAAAAGTCAAATGATTTATAATAT[G/A]
AAACTGAGAGATCACTAATTATTTACGCATCAATTCGTCATTTCTTTTTATTGGTCGGTGAGGAAAAACTCGAGCATGTGAGCATATGCAAACAAAATTT

Reverse complement sequence

AAATTTTGTTTGCATATGCTCACATGCTCGAGTTTTTCCTCACCGACCAATAAAAAGAAATGACGAATTGATGCGTAAATAATTAGTGATCTCTCAGTTT[C/T]
ATATTATAAATCATTTGACTTTTTTTCTACTCGAATTTTTTTTAAGTTTGACCAGATTTATAGAAAAATATAGTGGTTTTTTAACACAAAATAAACGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 10.90% 0.80% 0.00% NA
All Indica  2759 91.00% 9.00% 0.00% 0.00% NA
All Japonica  1512 80.40% 17.30% 2.38% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.10% 25.90% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.90% 0.00% 0.00% NA
Temperate Japonica  767 63.10% 32.70% 4.17% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.60% 4.10% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323847195 G -> A LOC_Os03g42810.1 upstream_gene_variant ; 2775.0bp to feature; MODIFIER silent_mutation Average:32.673; most accessible tissue: Callus, score: 60.354 N N N N
vg0323847195 G -> A LOC_Os03g42810.2 upstream_gene_variant ; 2775.0bp to feature; MODIFIER silent_mutation Average:32.673; most accessible tissue: Callus, score: 60.354 N N N N
vg0323847195 G -> A LOC_Os03g42799.1 downstream_gene_variant ; 2587.0bp to feature; MODIFIER silent_mutation Average:32.673; most accessible tissue: Callus, score: 60.354 N N N N
vg0323847195 G -> A LOC_Os03g42799-LOC_Os03g42810 intergenic_region ; MODIFIER silent_mutation Average:32.673; most accessible tissue: Callus, score: 60.354 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323847195 NA 5.13E-09 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323847195 NA 5.81E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 1.53E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 2.05E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 7.50E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 1.79E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 4.04E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 2.34E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 1.34E-07 1.34E-07 mr1597 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 2.87E-06 2.87E-06 mr1597 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 5.34E-06 6.83E-09 mr1788 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 9.70E-06 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 7.05E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323847195 NA 6.39E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251