\
| Variant ID: vg0323847195 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23847195 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACGTTTATTTTGTGTTAAAAAACCACTATATTTTTCTATAAATCTGGTCAAACTTAAAAAAAATTCGAGTAGAAAAAAAGTCAAATGATTTATAATAT[G/A]
AAACTGAGAGATCACTAATTATTTACGCATCAATTCGTCATTTCTTTTTATTGGTCGGTGAGGAAAAACTCGAGCATGTGAGCATATGCAAACAAAATTT
AAATTTTGTTTGCATATGCTCACATGCTCGAGTTTTTCCTCACCGACCAATAAAAAGAAATGACGAATTGATGCGTAAATAATTAGTGATCTCTCAGTTT[C/T]
ATATTATAAATCATTTGACTTTTTTTCTACTCGAATTTTTTTTAAGTTTGACCAGATTTATAGAAAAATATAGTGGTTTTTTAACACAAAATAAACGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 10.90% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.40% | 17.30% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.10% | 25.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 63.10% | 32.70% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323847195 | G -> A | LOC_Os03g42810.1 | upstream_gene_variant ; 2775.0bp to feature; MODIFIER | silent_mutation | Average:32.673; most accessible tissue: Callus, score: 60.354 | N | N | N | N |
| vg0323847195 | G -> A | LOC_Os03g42810.2 | upstream_gene_variant ; 2775.0bp to feature; MODIFIER | silent_mutation | Average:32.673; most accessible tissue: Callus, score: 60.354 | N | N | N | N |
| vg0323847195 | G -> A | LOC_Os03g42799.1 | downstream_gene_variant ; 2587.0bp to feature; MODIFIER | silent_mutation | Average:32.673; most accessible tissue: Callus, score: 60.354 | N | N | N | N |
| vg0323847195 | G -> A | LOC_Os03g42799-LOC_Os03g42810 | intergenic_region ; MODIFIER | silent_mutation | Average:32.673; most accessible tissue: Callus, score: 60.354 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323847195 | NA | 5.13E-09 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0323847195 | NA | 5.81E-06 | mr1106 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 1.53E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 2.05E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 7.50E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 1.79E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 4.04E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 2.34E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | 1.34E-07 | 1.34E-07 | mr1597 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | 2.87E-06 | 2.87E-06 | mr1597 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | 5.34E-06 | 6.83E-09 | mr1788 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 9.70E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 7.05E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323847195 | NA | 6.39E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |