\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323778716:

Variant ID: vg0323778716 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23778716
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGCTTGTCTGTCATGTTTGGATGATATATATATATGCATACATGTTAGTTGCCTGCCTACTGTATCAGTGCAGTACAATCGTGAATGTGTAAAACCCT[G/A]
TACAATGAGCTACATAATCTTACCGTGTATTCATCTCAAATGTCACCGTGTGCTAAATCTCACGGGAAGAATTTAAACATTCCCGGGCCACTAAAAACTC

Reverse complement sequence

GAGTTTTTAGTGGCCCGGGAATGTTTAAATTCTTCCCGTGAGATTTAGCACACGGTGACATTTGAGATGAATACACGGTAAGATTATGTAGCTCATTGTA[C/T]
AGGGTTTTACACATTCACGATTGTACTGCACTGATACAGTAGGCAGGCAACTAACATGTATGCATATATATATATCATCCAAACATGACAGACAAGCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 0.30% 3.43% 59.20% NA
All Indica  2759 3.60% 0.50% 5.84% 90.11% NA
All Japonica  1512 99.30% 0.00% 0.07% 0.60% NA
Aus  269 4.10% 0.00% 0.00% 95.91% NA
Indica I  595 2.50% 0.20% 4.20% 93.11% NA
Indica II  465 3.00% 0.00% 6.24% 90.75% NA
Indica III  913 3.00% 0.00% 5.59% 91.46% NA
Indica Intermediate  786 5.30% 1.70% 7.12% 85.88% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.20% 0.00% 0.20% 0.60% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 56.70% 0.00% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323778716 G -> A LOC_Os03g42710.1 upstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:8.907; most accessible tissue: Callus, score: 18.62 N N N N
vg0323778716 G -> A LOC_Os03g42690.1 downstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:8.907; most accessible tissue: Callus, score: 18.62 N N N N
vg0323778716 G -> A LOC_Os03g42700.1 downstream_gene_variant ; 1459.0bp to feature; MODIFIER silent_mutation Average:8.907; most accessible tissue: Callus, score: 18.62 N N N N
vg0323778716 G -> A LOC_Os03g42690-LOC_Os03g42700 intergenic_region ; MODIFIER silent_mutation Average:8.907; most accessible tissue: Callus, score: 18.62 N N N N
vg0323778716 G -> DEL N N silent_mutation Average:8.907; most accessible tissue: Callus, score: 18.62 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323778716 NA 6.64E-09 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323778716 NA 7.16E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 7.27E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 4.59E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 2.98E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 1.13E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 3.15E-09 mr1254 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 2.00E-06 2.45E-06 mr1286 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 7.54E-06 1.19E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 5.31E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 4.09E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 3.93E-06 5.84E-06 mr1419 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 7.11E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 4.70E-08 mr1511 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 3.58E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 5.23E-07 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 3.01E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 1.01E-06 3.11E-07 mr1665 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 3.84E-06 2.93E-07 mr1665 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 3.46E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 6.78E-06 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 2.34E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 3.03E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 5.80E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716 NA 1.12E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251