Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323778716:

Variant ID: vg0323778716 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23778716
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGCTTGTCTGTCATGTTTGGATGATATATATATATGCATACATGTTAGTTGCCTGCCTACTGTATCAGTGCAGTACAATCGTGAATGTGTAAAACCCT[G/A]
TACAATGAGCTACATAATCTTACCGTGTATTCATCTCAAATGTCACCGTGTGCTAAATCTCACGGGAAGAATTTAAACATTCCCGGGCCACTAAAAACTC

Reverse complement sequence

GAGTTTTTAGTGGCCCGGGAATGTTTAAATTCTTCCCGTGAGATTTAGCACACGGTGACATTTGAGATGAATACACGGTAAGATTATGTAGCTCATTGTA[C/T]
AGGGTTTTACACATTCACGATTGTACTGCACTGATACAGTAGGCAGGCAACTAACATGTATGCATATATATATATCATCCAAACATGACAGACAAGCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	0.30%	3.43%	59.20%	NA
All Indica	2759	3.60%	0.50%	5.84%	90.11%	NA
All Japonica	1512	99.30%	0.00%	0.07%	0.60%	NA
Aus	269	4.10%	0.00%	0.00%	95.91%	NA
Indica I	595	2.50%	0.20%	4.20%	93.11%	NA
Indica II	465	3.00%	0.00%	6.24%	90.75%	NA
Indica III	913	3.00%	0.00%	5.59%	91.46%	NA
Indica Intermediate	786	5.30%	1.70%	7.12%	85.88%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	56.70%	0.00%	0.00%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323778716	G -> A	LOC_Os03g42710.1	upstream_gene_variant ; 2395.0bp to feature; MODIFIER	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 18.62	N	N	N	N
vg0323778716	G -> A	LOC_Os03g42690.1	downstream_gene_variant ; 532.0bp to feature; MODIFIER	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 18.62	N	N	N	N
vg0323778716	G -> A	LOC_Os03g42700.1	downstream_gene_variant ; 1459.0bp to feature; MODIFIER	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 18.62	N	N	N	N
vg0323778716	G -> A	LOC_Os03g42690-LOC_Os03g42700	intergenic_region ; MODIFIER	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 18.62	N	N	N	N
vg0323778716	G -> DEL	N	N	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 18.62	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323778716	NA	6.64E-09	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323778716	NA	7.16E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	7.27E-08	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	4.59E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	2.98E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	1.13E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	3.15E-09	mr1254	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	2.00E-06	2.45E-06	mr1286	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	7.54E-06	1.19E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	5.31E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	4.09E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	3.93E-06	5.84E-06	mr1419	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	7.11E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	4.70E-08	mr1511	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	3.58E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	5.23E-07	mr1607	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	3.01E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	1.01E-06	3.11E-07	mr1665	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	3.84E-06	2.93E-07	mr1665	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	3.46E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	6.78E-06	mr1816	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	2.34E-07	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	3.03E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	5.80E-07	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323778716	NA	1.12E-07	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251