Variant ID: vg0323687205 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 23687205 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATATTCTTTTAGAGAGAGTGTGACTGTGTGAGAGATAGAAACTAGAGAGAGAGAGTAGTTAATTTCTATCAAATCCTTTCACGGGCCGTTTGGTTAGG[A/G]
GGAGTTTTTAGGAGGGATTAGGAGTTTAGTGGGATGAGGATATTAACTACTCCCTCCGTATTTTAATGTATGACGTTGTTGACTTTTCGACAAACGTTTG
CAAACGTTTGTCGAAAAGTCAACAACGTCATACATTAAAATACGGAGGGAGTAGTTAATATCCTCATCCCACTAAACTCCTAATCCCTCCTAAAAACTCC[T/C]
CCTAACCAAACGGCCCGTGAAAGGATTTGATAGAAATTAACTACTCTCTCTCTCTAGTTTCTATCTCTCACACAGTCACACTCTCTCTAAAAGAATATAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.90% | 13.00% | 0.08% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 65.90% | 33.80% | 0.26% | 0.00% | NA |
Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 48.80% | 51.10% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 74.70% | 24.10% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0323687205 | A -> G | LOC_Os03g42550.1 | upstream_gene_variant ; 2289.0bp to feature; MODIFIER | silent_mutation | Average:45.113; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
vg0323687205 | A -> G | LOC_Os03g42540-LOC_Os03g42550 | intergenic_region ; MODIFIER | silent_mutation | Average:45.113; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0323687205 | 5.11E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 4.72E-06 | NA | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 2.75E-06 | NA | mr1379_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | NA | 1.40E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 5.42E-06 | 2.02E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 3.15E-06 | NA | mr1559_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | NA | 1.19E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 4.83E-07 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | 2.26E-06 | 2.26E-06 | mr1649_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0323687205 | NA | 1.70E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |