\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323589698:

Variant ID: vg0323589698 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23589698
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTCGCAACTGAGCATGCAAGCTCCAACCTATTTGGTTCTATAATGACTATAAGTGGTACTTTCAGATTCAGCATATGCAGAGACTTATAACAGCAGG[C/T]
TAGTATCGGTCTGAAATTCATTTCCAATTGATCCCCAACGAGCAGAAAAGACCAGGCTGGTACTTTCAGATTCAGCATATGCAGAGACTTAAAACAGTAG

Reverse complement sequence

CTACTGTTTTAAGTCTCTGCATATGCTGAATCTGAAAGTACCAGCCTGGTCTTTTCTGCTCGTTGGGGATCAATTGGAAATGAATTTCAGACCGATACTA[G/A]
CCTGCTGTTATAAGTCTCTGCATATGCTGAATCTGAAAGTACCACTTATAGTCATTATAGAACCAAATAGGTTGGAGCTTGCATGCTCAGTTGCGAACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 8.70% 5.61% 0.00% NA
All Indica  2759 82.80% 10.80% 6.42% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 27.90% 40.50% 31.60% 0.00% NA
Indica I  595 70.90% 22.40% 6.72% 0.00% NA
Indica II  465 84.50% 8.60% 6.88% 0.00% NA
Indica III  913 91.20% 4.90% 3.83% 0.00% NA
Indica Intermediate  786 80.90% 10.20% 8.91% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323589698 C -> T LOC_Os03g42380.1 upstream_gene_variant ; 1653.0bp to feature; MODIFIER silent_mutation Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N
vg0323589698 C -> T LOC_Os03g42400.1 upstream_gene_variant ; 2436.0bp to feature; MODIFIER silent_mutation Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N
vg0323589698 C -> T LOC_Os03g42380-LOC_Os03g42400 intergenic_region ; MODIFIER silent_mutation Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323589698 NA 8.88E-07 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 7.71E-06 mr1106 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 7.95E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 4.64E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 5.09E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 1.32E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 2.83E-07 2.83E-07 mr1459 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 3.52E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 4.77E-08 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698 NA 2.17E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251