Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0323589698:

Variant ID: vg0323589698 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23589698
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTCGCAACTGAGCATGCAAGCTCCAACCTATTTGGTTCTATAATGACTATAAGTGGTACTTTCAGATTCAGCATATGCAGAGACTTATAACAGCAGG[C/T]
TAGTATCGGTCTGAAATTCATTTCCAATTGATCCCCAACGAGCAGAAAAGACCAGGCTGGTACTTTCAGATTCAGCATATGCAGAGACTTAAAACAGTAG

Reverse complement sequence

CTACTGTTTTAAGTCTCTGCATATGCTGAATCTGAAAGTACCAGCCTGGTCTTTTCTGCTCGTTGGGGATCAATTGGAAATGAATTTCAGACCGATACTA[G/A]
CCTGCTGTTATAAGTCTCTGCATATGCTGAATCTGAAAGTACCACTTATAGTCATTATAGAACCAAATAGGTTGGAGCTTGCATGCTCAGTTGCGAACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	8.70%	5.61%	0.00%	NA
All Indica	2759	82.80%	10.80%	6.42%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	27.90%	40.50%	31.60%	0.00%	NA
Indica I	595	70.90%	22.40%	6.72%	0.00%	NA
Indica II	465	84.50%	8.60%	6.88%	0.00%	NA
Indica III	913	91.20%	4.90%	3.83%	0.00%	NA
Indica Intermediate	786	80.90%	10.20%	8.91%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323589698	C -> T	LOC_Os03g42380.1	upstream_gene_variant ; 1653.0bp to feature; MODIFIER	silent_mutation	Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683	N	N	N	N
vg0323589698	C -> T	LOC_Os03g42400.1	upstream_gene_variant ; 2436.0bp to feature; MODIFIER	silent_mutation	Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683	N	N	N	N
vg0323589698	C -> T	LOC_Os03g42380-LOC_Os03g42400	intergenic_region ; MODIFIER	silent_mutation	Average:42.029; most accessible tissue: Zhenshan97 flower, score: 73.683	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323589698	NA	8.88E-07	mr1106	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	7.71E-06	mr1106	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	7.95E-07	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	4.64E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	5.09E-06	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	1.32E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	2.83E-07	2.83E-07	mr1459	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	3.52E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	4.77E-08	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323589698	NA	2.17E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251