\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323102859:

Variant ID: vg0323102859 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23102859
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CGGATATATGGAGGGAGTTTCGGATAAGGAAAGACATCCAGAGTTCTACATGGAAACGACAAGGACTACTCGAATTGTATCCATATTGGTTTCCCTAGTT[C/T]
TACTTGGACAAGGGGACACCTATGGTTATAAATACAAGGCCCCCTAGGAGGAGAGGGGGGACAATCAACACACCCACCATAGAAGACACCCATCACAATC

Reverse complement sequence

GATTGTGATGGGTGTCTTCTATGGTGGGTGTGTTGATTGTCCCCCCTCTCCTCCTAGGGGGCCTTGTATTTATAACCATAGGTGTCCCCTTGTCCAAGTA[G/A]
AACTAGGGAAACCAATATGGATACAATTCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGATGTCTTTCCTTATCCGAAACTCCCTCCATATATCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 36.70% 1.29% 1.12% NA
All Indica  2759 92.80% 3.10% 2.21% 1.92% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 90.30% 3.00% 3.44% 3.23% NA
Indica III  913 89.60% 4.10% 3.61% 2.74% NA
Indica Intermediate  786 93.80% 3.30% 1.27% 1.65% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323102859 C -> T LOC_Os03g41540.1 downstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:41.156; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0323102859 C -> T LOC_Os03g41540-LOC_Os03g41570 intergenic_region ; MODIFIER silent_mutation Average:41.156; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0323102859 C -> DEL N N silent_mutation Average:41.156; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323102859 NA 1.68E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323102859 NA 3.95E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 6.70E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 8.75E-07 8.81E-09 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 7.21E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 5.29E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 2.98E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 3.12E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 9.26E-30 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 8.67E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 2.15E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 5.83E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 6.75E-07 1.88E-08 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 1.48E-35 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323102859 NA 3.86E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251