\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323085855:

Variant ID: vg0323085855 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23085855
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTTAAAAGTGATTGGACCTAAAGTTTAGGAGGGGTTAATTTAAGAGCAGTCCCGCGTTTCCAATATGTGGCACTGTGGTGCGCGGGACCGAAGTCC[G/A]
TCCTGCATAAGCATTCTGCGGGACCAAGCTGGTGCCGACCGGTCCTGCAAACCACCGTGATGTCGCATGCCCAATGTGCGGGTGCGCCCCGGTGCCGCAT

Reverse complement sequence

ATGCGGCACCGGGGCGCACCCGCACATTGGGCATGCGACATCACGGTGGTTTGCAGGACCGGTCGGCACCAGCTTGGTCCCGCAGAATGCTTATGCAGGA[C/T]
GGACTTCGGTCCCGCGCACCACAGTGCCACATATTGGAAACGCGGGACTGCTCTTAAATTAACCCCTCCTAAACTTTAGGTCCAATCACTTTTAAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 13.70% 1.90% 0.00% NA
All Indica  2759 99.50% 0.40% 0.14% 0.00% NA
All Japonica  1512 56.90% 37.50% 5.62% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.00% 0.25% 0.00% NA
Temperate Japonica  767 84.50% 7.70% 7.82% 0.00% NA
Tropical Japonica  504 14.70% 83.30% 1.98% 0.00% NA
Japonica Intermediate  241 57.30% 36.50% 6.22% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323085855 G -> A LOC_Os03g41500.1 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.1 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.3 upstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.6 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.2 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.4 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.5 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.8 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41510.7 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0323085855 G -> A LOC_Os03g41500-LOC_Os03g41510 intergenic_region ; MODIFIER silent_mutation Average:88.301; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323085855 G A 0.01 0.0 0.0 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323085855 NA 2.56E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.67E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 4.56E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 4.15E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.97E-06 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 8.81E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.45E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 6.70E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 8.62E-06 NA mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 3.41E-06 NA mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.24E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 2.88E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 3.35E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.01E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.46E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 8.35E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 8.48E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.50E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 1.72E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 2.49E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 6.57E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 5.55E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 NA 9.81E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323085855 9.44E-06 9.43E-06 mr1992_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251