Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322438729:

Variant ID: vg0322438729 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22438729
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GATACAAGGAAGTGGACATAAACTATTTTCATAAGATAAGATGCATAGATTATTTTCAGTTTTATTGGCTTGATCTCTTGCAGTTAAGTGCCATATATAT[A/T]
TTAGTATTTGACATGTGGAACTATAGCCACGAATCCGTTTACTGACAGATCAAATCCTCCAAGCATAATTGACTATAATAAAGAACACATTGGATTTGAA

Reverse complement sequence

TTCAAATCCAATGTGTTCTTTATTATAGTCAATTATGCTTGGAGGATTTGATCTGTCAGTAAACGGATTCGTGGCTATAGTTCCACATGTCAAATACTAA[T/A]
ATATATATGGCACTTAACTGCAAGAGATCAAGCCAATAAAACTGAAAATAATCTATGCATCTTATCTTATGAAAATAGTTTATGTCCACTTCCTTGTATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	7.20%	3.68%	0.00%	NA
All Indica	2759	99.60%	0.20%	0.14%	0.00%	NA
All Japonica	1512	67.50%	21.80%	10.78%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.50%	1.10%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	48.50%	34.30%	17.21%	0.00%	NA
Tropical Japonica	504	92.70%	3.00%	4.37%	0.00%	NA
Japonica Intermediate	241	75.10%	21.20%	3.73%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	7.80%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322438729	A -> T	LOC_Os03g40370.1	upstream_gene_variant ; 2619.0bp to feature; MODIFIER	silent_mutation	Average:38.737; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0322438729	A -> T	LOC_Os03g40380.1	upstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:38.737; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0322438729	A -> T	LOC_Os03g40390.1	upstream_gene_variant ; 4544.0bp to feature; MODIFIER	silent_mutation	Average:38.737; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0322438729	A -> T	LOC_Os03g40370-LOC_Os03g40380	intergenic_region ; MODIFIER	silent_mutation	Average:38.737; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322438729	4.85E-06	NA	mr1092	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322438729	NA	9.60E-06	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251