\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322274602:

Variant ID: vg0322274602 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22274602
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ATGACGCCGCCGTTGTCAGCCGGCCAAATGGCTCGGCAAGGCTTTCGCCCGCGATTCCCTGTCCAAACCCACACCACCAATCCGCACAAGAAGGATCGTC[G/A]
TCGGTCAACAACATTATCCCTTCAGCGATTCGGCCAAGGCCACCGTCAATAATTGTTCCCGCTGTCGCTCAATCATGCAGATAGACCAAAGCCAACTTGT

Reverse complement sequence

ACAAGTTGGCTTTGGTCTATCTGCATGATTGAGCGACAGCGGGAACAATTATTGACGGTGGCCTTGGCCGAATCGCTGAAGGGATAATGTTGTTGACCGA[C/T]
GACGATCCTTCTTGTGCGGATTGGTGGTGTGGGTTTGGACAGGGAATCGCGGGCGAAAGCCTTGCCGAGCCATTTGGCCGGCTGACAACGGCGGCGTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 20.00% 0.02% 0.00% NA
All Indica  2759 70.30% 29.60% 0.04% 0.00% NA
All Japonica  1512 93.30% 6.70% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 26.90% 73.10% 0.00% 0.00% NA
Indica II  465 88.20% 11.60% 0.22% 0.00% NA
Indica III  913 80.10% 19.90% 0.00% 0.00% NA
Indica Intermediate  786 81.30% 18.70% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322274602 G -> A LOC_Os03g40090.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0322274602 G -> A LOC_Os03g40084.1 downstream_gene_variant ; 4581.0bp to feature; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 root, score: 87.205 N N N N
vg0322274602 G -> A LOC_Os03g40090-LOC_Os03g40100 intergenic_region ; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 root, score: 87.205 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322274602 G A -0.09 0.04 0.0 -0.03 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322274602 NA 1.13E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 1.93E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 2.16E-07 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 1.15E-09 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 5.87E-08 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 4.31E-08 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 6.20E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 5.02E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 5.45E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 3.78E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 3.03E-07 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 1.73E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 7.65E-06 7.25E-08 mr1539_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 3.59E-08 mr1540_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 1.89E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 2.27E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322274602 NA 5.98E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251