Search for Variation information by Variation ID:
Detailed information for vg0321972978:
| Variant ID: vg0321972978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21972978 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, others allele: 0.00, population size: 168. )
Flanking Sequence (100 bp) in Reference Genome:
ATCACGGTTAACAGTTTACATATTAAGTTTACTTACCCCTTCTTTAGGGGGAATGTAGTCCTTGTCGCCTTCTTCACCGTCGCCCTTTTTCCTTCTCTTC[A/G]
GGCTTGGGCTTGGACAAGGATCGCTTGGCGACGAGTACTCATCGTCTTCGTGAGCAACGTCGCTGTCAGAACTATCTTCTGGTGGGACCGTTGGTTCCGG
Reverse complement sequence
CCGGAACCAACGGTCCCACCAGAAGATAGTTCTGACAGCGACGTTGCTCACGAAGACGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCC[T/C]
GAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGTAAGTAAACTTAATATGTAAACTGTTAACCGTGAT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 33.20% | 0.91% | 16.23% | NA |
| All Indica | 2759 | 65.70% | 5.30% | 1.41% | 27.51% | NA |
| All Japonica | 1512 | 8.90% | 91.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 25.00% | 6.10% | 1.51% | 67.39% | NA |
| Indica II | 465 | 85.60% | 3.90% | 0.43% | 10.11% | NA |
| Indica III | 913 | 72.40% | 5.10% | 2.52% | 19.93% | NA |
| Indica Intermediate | 786 | 77.10% | 5.90% | 0.64% | 16.41% | NA |
| Temperate Japonica | 767 | 0.70% | 99.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 42.20% | 3.33% | 7.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321972978 | A -> DEL | LOC_Os03g39570.1 | N | frameshift_variant | Average:14.322; most accessible tissue: Callus, score: 54.268 | N | N | N | N |
| vg0321972978 | A -> G | LOC_Os03g39570.1 | missense_variant ; p.Leu38Pro; MODERATE | nonsynonymous_codon ; L38P | Average:14.322; most accessible tissue: Callus, score: 54.268 | benign  |
-0.378 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321972978 | NA | 8.12E-07 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | 3.29E-06 | 3.95E-06 | mr1404 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 5.23E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 5.80E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | 4.06E-07 | 4.06E-07 | mr1067_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 7.65E-07 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 2.52E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 8.19E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | 3.56E-08 | 3.37E-08 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | NA | 8.13E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321972978 | 8.04E-06 | NA | mr1987_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |