| Variant ID: vg0321862928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21862928 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )
ATATTTACCACTCTATGAAACTTCCAGCGGCTTGATTGTCTAGATATTGTTCTTCTCTTCATACTTAATGCTGCATCAGTTGAGTTTGATTTATTAAGTC[G/A]
TGCTTAGAAGATCAATCTCTAACCTGTCTTCTGGTTGCCGATTAGGGTAGCATCGGAGTTTCAGCCGATCTTATCTGATTTAACTATATTTGCTTTATAT
ATATAAAGCAAATATAGTTAAATCAGATAAGATCGGCTGAAACTCCGATGCTACCCTAATCGGCAACCAGAAGACAGGTTAGAGATTGATCTTCTAAGCA[C/T]
GACTTAATAAATCAAACTCAACTGATGCAGCATTAAGTATGAAGAGAAGAACAATATCTAGACAATCAAGCCGCTGGAAGTTTCATAGAGTGGTAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 0.70% | 15.51% | 14.24% | NA |
| All Indica | 2759 | 56.40% | 1.10% | 19.75% | 22.80% | NA |
| All Japonica | 1512 | 98.50% | 0.00% | 0.46% | 1.06% | NA |
| Aus | 269 | 30.10% | 0.00% | 63.20% | 6.69% | NA |
| Indica I | 595 | 89.70% | 0.00% | 2.86% | 7.39% | NA |
| Indica II | 465 | 42.40% | 0.90% | 12.90% | 43.87% | NA |
| Indica III | 913 | 44.00% | 1.50% | 35.27% | 19.17% | NA |
| Indica Intermediate | 786 | 53.80% | 1.40% | 18.58% | 26.21% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 1.39% | 2.98% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 3.30% | 12.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321862928 | G -> A | LOC_Os03g39350.1 | upstream_gene_variant ; 3754.0bp to feature; MODIFIER | silent_mutation | Average:33.709; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0321862928 | G -> A | LOC_Os03g39330-LOC_Os03g39350 | intergenic_region ; MODIFIER | silent_mutation | Average:33.709; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0321862928 | G -> DEL | N | N | silent_mutation | Average:33.709; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321862928 | NA | 1.49E-06 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321862928 | NA | 4.64E-06 | mr1689 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321862928 | 4.66E-06 | 3.69E-07 | mr1517_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |