\
| Variant ID: vg0321808235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21808235 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 84. )
TGAGCTATGCGAACCTGCTCCACCAATGTGGGCTGTGCCTCTAGGGCAGCCACGAATCCGTGCTCAACTATACTAAGGTTCAGATGTTCCAAATCACGTT[T/G]
AACCTCACAACACAGTTTCTCTACCCATGCAACATTGCAGTAACTCTTCCTGCTTAAGGCGTCTGCTACCACATTAGCCTTGCCGGCATGATAGTGTATT
AATACACTATCATGCCGGCAAGGCTAATGTGGTAGCAGACGCCTTAAGCAGGAAGAGTTACTGCAATGTTGCATGGGTAGAGAAACTGTGTTGTGAGGTT[A/C]
AACGTGATTTGGAACATCTGAACCTTAGTATAGTTGAGCACGGATTCGTGGCTGCCCTAGAGGCACAGCCCACATTGGTGGAGCAGGTTCGCATAGCTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 25.10% | 3.89% | 38.47% | NA |
| All Indica | 2759 | 4.80% | 34.10% | 4.64% | 56.51% | NA |
| All Japonica | 1512 | 89.80% | 8.50% | 0.60% | 1.06% | NA |
| Aus | 269 | 1.10% | 2.20% | 15.61% | 81.04% | NA |
| Indica I | 595 | 5.40% | 72.40% | 1.85% | 20.34% | NA |
| Indica II | 465 | 4.50% | 14.20% | 4.95% | 76.34% | NA |
| Indica III | 913 | 1.90% | 29.20% | 4.93% | 63.96% | NA |
| Indica Intermediate | 786 | 7.90% | 22.40% | 6.23% | 63.49% | NA |
| Temperate Japonica | 767 | 97.90% | 2.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.90% | 5.60% | 1.79% | 2.78% | NA |
| Japonica Intermediate | 241 | 63.90% | 35.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 2.10% | 92.70% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 46.70% | 25.60% | 4.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321808235 | T -> DEL | LOC_Os03g39250.1 | N | frameshift_variant | Average:43.517; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0321808235 | T -> G | LOC_Os03g39250.1 | missense_variant ; p.Lys914Gln; MODERATE | nonsynonymous_codon ; K914Q | Average:43.517; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | benign |
-0.99 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321808235 | NA | 4.88E-08 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 5.45E-08 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 2.75E-11 | mr1130 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 5.37E-10 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 5.23E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 1.24E-07 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 2.17E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 1.85E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 1.44E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 5.03E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 2.43E-06 | mr1680 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 1.12E-06 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321808235 | NA | 8.51E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |