Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321781118:

Variant ID: vg0321781118 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21781118
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTCAGGTCTGTGGGTTGAGGTTGTATATCACTTGTGACTACTAGCAAACATGCACTATACCTATATGTAAAAAATCGCGGTTGAACCGCCGGTTCATT[G/T]
GTCAGACCGGCGGACCGGTGAACCGAAAGGTCCGCCGGGTCAAGCTCCGGTCCGAGTTTTTATACTATGGCGCGGAGAGGGGGCGGCGGACGCGTCGCGC

Reverse complement sequence

GCGCGACGCGTCCGCCGCCCCCTCTCCGCGCCATAGTATAAAAACTCGGACCGGAGCTTGACCCGGCGGACCTTTCGGTTCACCGGTCCGCCGGTCTGAC[C/A]
AATGAACCGGCGGTTCAACCGCGATTTTTTACATATAGGTATAGTGCATGTTTGCTAGTAGTCACAAGTGATATACAACCTCAACCCACAGACCTGAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	4.00%	4.59%	13.25%	NA
All Indica	2759	70.50%	0.00%	6.96%	22.51%	NA
All Japonica	1512	86.30%	12.20%	1.46%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	34.30%	0.00%	22.52%	43.19%	NA
Indica II	465	90.10%	0.00%	1.51%	8.39%	NA
Indica III	913	73.80%	0.00%	1.20%	24.97%	NA
Indica Intermediate	786	82.40%	0.10%	5.09%	12.34%	NA
Temperate Japonica	767	99.20%	0.10%	0.52%	0.13%	NA
Tropical Japonica	504	63.90%	33.30%	2.78%	0.00%	NA
Japonica Intermediate	241	92.10%	6.20%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	2.20%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321781118	G -> T	LOC_Os03g39210.1	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0321781118	G -> T	LOC_Os03g39224.1	upstream_gene_variant ; 3101.0bp to feature; MODIFIER	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0321781118	G -> T	LOC_Os03g39220.1	downstream_gene_variant ; 1064.0bp to feature; MODIFIER	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0321781118	G -> T	LOC_Os03g39230.1	downstream_gene_variant ; 3730.0bp to feature; MODIFIER	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0321781118	G -> T	LOC_Os03g39210-LOC_Os03g39220	intergenic_region ; MODIFIER	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0321781118	G -> DEL	N	N	silent_mutation	Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321781118	NA	1.92E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	3.67E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	8.51E-06	1.18E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	2.98E-07	2.98E-07	mr1085	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	4.22E-07	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	2.78E-06	2.78E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	5.85E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	1.10E-07	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	4.89E-07	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	1.63E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	1.93E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	7.58E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	8.25E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	3.47E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	1.97E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	2.34E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	7.68E-06	7.68E-06	mr1145_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	2.88E-10	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118	NA	2.87E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251