\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321781118:

Variant ID: vg0321781118 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21781118
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTCAGGTCTGTGGGTTGAGGTTGTATATCACTTGTGACTACTAGCAAACATGCACTATACCTATATGTAAAAAATCGCGGTTGAACCGCCGGTTCATT[G/T]
GTCAGACCGGCGGACCGGTGAACCGAAAGGTCCGCCGGGTCAAGCTCCGGTCCGAGTTTTTATACTATGGCGCGGAGAGGGGGCGGCGGACGCGTCGCGC

Reverse complement sequence

GCGCGACGCGTCCGCCGCCCCCTCTCCGCGCCATAGTATAAAAACTCGGACCGGAGCTTGACCCGGCGGACCTTTCGGTTCACCGGTCCGCCGGTCTGAC[C/A]
AATGAACCGGCGGTTCAACCGCGATTTTTTACATATAGGTATAGTGCATGTTTGCTAGTAGTCACAAGTGATATACAACCTCAACCCACAGACCTGAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 4.00% 4.59% 13.25% NA
All Indica  2759 70.50% 0.00% 6.96% 22.51% NA
All Japonica  1512 86.30% 12.20% 1.46% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 34.30% 0.00% 22.52% 43.19% NA
Indica II  465 90.10% 0.00% 1.51% 8.39% NA
Indica III  913 73.80% 0.00% 1.20% 24.97% NA
Indica Intermediate  786 82.40% 0.10% 5.09% 12.34% NA
Temperate Japonica  767 99.20% 0.10% 0.52% 0.13% NA
Tropical Japonica  504 63.90% 33.30% 2.78% 0.00% NA
Japonica Intermediate  241 92.10% 6.20% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 2.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321781118 G -> T LOC_Os03g39210.1 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0321781118 G -> T LOC_Os03g39224.1 upstream_gene_variant ; 3101.0bp to feature; MODIFIER silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0321781118 G -> T LOC_Os03g39220.1 downstream_gene_variant ; 1064.0bp to feature; MODIFIER silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0321781118 G -> T LOC_Os03g39230.1 downstream_gene_variant ; 3730.0bp to feature; MODIFIER silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0321781118 G -> T LOC_Os03g39210-LOC_Os03g39220 intergenic_region ; MODIFIER silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0321781118 G -> DEL N N silent_mutation Average:19.645; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321781118 NA 1.92E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 3.67E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 8.51E-06 1.18E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 2.98E-07 2.98E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 4.22E-07 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 2.78E-06 2.78E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 5.85E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 1.10E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 4.89E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 1.63E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 1.93E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 7.58E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 8.25E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 3.47E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 1.97E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 2.34E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 7.68E-06 7.68E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 2.88E-10 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321781118 NA 2.87E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251