Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321533612:

Variant ID: vg0321533612 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21533612
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCGCCCGCGCCCCAAGGTCATTAAGGGCCAGCCGAAGAGTGTAACAGGCCTCCTTGGCGGACTCTATGGCTGGCACCAGGGTTGCGGCCGTAGCTTCG[G/A]
CCGACGCAAGACAGGCTTCGAGGGATTTAATCTTCTCCTCGGCCGAAGCAAGTTGTCAGTCTCGTTCGGCGTCCCGCTGGCGTGATGCTTCTAGGTTAGA

Reverse complement sequence

TCTAACCTAGAAGCATCACGCCAGCGGGACGCCGAACGAGACTGACAACTTGCTTCGGCCGAGGAGAAGATTAAATCCCTCGAAGCCTGTCTTGCGTCGG[C/T]
CGAAGCTACGGCCGCAACCCTGGTGCCAGCCATAGAGTCCGCCAAGGAGGCCTGTTACACTCTTCGGCTGGCCCTTAATGACCTTGGGGCGCGGGCGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	45.00%	0.11%	0.00%	NA
All Indica	2759	80.70%	19.10%	0.18%	0.00%	NA
All Japonica	1512	8.10%	91.90%	0.00%	0.00%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	44.40%	55.10%	0.50%	0.00%	NA
Indica II	465	93.30%	6.50%	0.22%	0.00%	NA
Indica III	913	95.90%	4.10%	0.00%	0.00%	NA
Indica Intermediate	786	83.10%	16.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.50%	93.50%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321533612	G -> A	LOC_Os03g38764.1	downstream_gene_variant ; 2204.0bp to feature; MODIFIER	silent_mutation	Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0321533612	G -> A	LOC_Os03g38780.1	downstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0321533612	G -> A	LOC_Os03g38764-LOC_Os03g38780	intergenic_region ; MODIFIER	silent_mutation	Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321533612	NA	5.13E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	NA	7.50E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	9.01E-07	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	1.86E-09	NA	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	NA	4.67E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	NA	2.89E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	NA	3.25E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612	NA	1.17E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251