\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321533612:

Variant ID: vg0321533612 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21533612
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCGCCCGCGCCCCAAGGTCATTAAGGGCCAGCCGAAGAGTGTAACAGGCCTCCTTGGCGGACTCTATGGCTGGCACCAGGGTTGCGGCCGTAGCTTCG[G/A]
CCGACGCAAGACAGGCTTCGAGGGATTTAATCTTCTCCTCGGCCGAAGCAAGTTGTCAGTCTCGTTCGGCGTCCCGCTGGCGTGATGCTTCTAGGTTAGA

Reverse complement sequence

TCTAACCTAGAAGCATCACGCCAGCGGGACGCCGAACGAGACTGACAACTTGCTTCGGCCGAGGAGAAGATTAAATCCCTCGAAGCCTGTCTTGCGTCGG[C/T]
CGAAGCTACGGCCGCAACCCTGGTGCCAGCCATAGAGTCCGCCAAGGAGGCCTGTTACACTCTTCGGCTGGCCCTTAATGACCTTGGGGCGCGGGCGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 45.00% 0.11% 0.00% NA
All Indica  2759 80.70% 19.10% 0.18% 0.00% NA
All Japonica  1512 8.10% 91.90% 0.00% 0.00% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 44.40% 55.10% 0.50% 0.00% NA
Indica II  465 93.30% 6.50% 0.22% 0.00% NA
Indica III  913 95.90% 4.10% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.80% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 6.50% 93.50% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321533612 G -> A LOC_Os03g38764.1 downstream_gene_variant ; 2204.0bp to feature; MODIFIER silent_mutation Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg0321533612 G -> A LOC_Os03g38780.1 downstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg0321533612 G -> A LOC_Os03g38764-LOC_Os03g38780 intergenic_region ; MODIFIER silent_mutation Average:44.333; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321533612 NA 5.13E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 NA 7.50E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 9.01E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 1.86E-09 NA mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 NA 4.67E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 NA 2.89E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 NA 3.25E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321533612 NA 1.17E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251