Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321480693:

Variant ID: vg0321480693 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21480693
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTAGCACAGCTCCATCTCTTTTAAAGTTAGAGCTCAACTAAACAGTTTCAGCTCCACCTAAAATGAGAACGGAGTTAGGTAGAGCTTTATCATAAAAT[G/A]
AACTAGAGATGTGAAGCTAGATTTAGACAGCTGTACAACTCCACTTCAAACCAACTCTTATAGCTAAATTTAAAAATTTGAGCTCTACCAAACAGGCTGT

Reverse complement sequence

ACAGCCTGTTTGGTAGAGCTCAAATTTTTAAATTTAGCTATAAGAGTTGGTTTGAAGTGGAGTTGTACAGCTGTCTAAATCTAGCTTCACATCTCTAGTT[C/T]
ATTTTATGATAAAGCTCTACCTAACTCCGTTCTCATTTTAGGTGGAGCTGAAACTGTTTAGTTGAGCTCTAACTTTAAAAGAGATGGAGCTGTGCTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.30%	29.20%	1.67%	34.81%	NA
All Indica	2759	3.50%	39.90%	2.21%	54.44%	NA
All Japonica	1512	91.30%	0.30%	0.93%	7.47%	NA
Aus	269	3.00%	96.30%	0.37%	0.37%	NA
Indica I	595	3.90%	77.80%	1.18%	17.14%	NA
Indica II	465	4.30%	14.60%	2.15%	78.92%	NA
Indica III	913	1.90%	37.70%	2.85%	57.61%	NA
Indica Intermediate	786	4.60%	28.60%	2.29%	64.50%	NA
Temperate Japonica	767	99.30%	0.10%	0.00%	0.52%	NA
Tropical Japonica	504	90.70%	0.60%	2.58%	6.15%	NA
Japonica Intermediate	241	66.80%	0.40%	0.41%	32.37%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	53.30%	14.40%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321480693	G -> A	LOC_Os03g38689.1	upstream_gene_variant ; 679.0bp to feature; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0321480693	G -> A	LOC_Os03g38700.1	downstream_gene_variant ; 2127.0bp to feature; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0321480693	G -> A	LOC_Os03g38710.1	downstream_gene_variant ; 3155.0bp to feature; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0321480693	G -> A	LOC_Os03g38689-LOC_Os03g38700	intergenic_region ; MODIFIER	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0321480693	G -> DEL	N	N	silent_mutation	Average:48.331; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321480693	NA	5.14E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	1.49E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	6.14E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	8.80E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	7.46E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	1.42E-11	mr1222	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	1.95E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	4.18E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	7.51E-08	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	2.87E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	3.48E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	3.64E-09	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	5.15E-07	mr1857	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	1.29E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	1.78E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	6.17E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321480693	NA	7.63E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251