Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0321319909:

Variant ID: vg0321319909 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21319909
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.32, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACTTGAAGTAAAGGTAGTGGGAGAATCACTACACCACTGGTCGAGGACCAGGTAGTAGTCGTATCTTGACCACTTAAAGTGGAAGTAGTGGGAGAAA[C/T]
GCTACACCGCTGGTCGAGGACCAGGTAGTAGTCGTAAATTGACCACTAGAAGTAAATGTACGAGATATCGCTACGATTAACTGGTTGAGAACCAGTGAGT

Reverse complement sequence

ACTCACTGGTTCTCAACCAGTTAATCGTAGCGATATCTCGTACATTTACTTCTAGTGGTCAATTTACGACTACTACCTGGTCCTCGACCAGCGGTGTAGC[G/A]
TTTCTCCCACTACTTCCACTTTAAGTGGTCAAGATACGACTACTACCTGGTCCTCGACCAGTGGTGTAGTGATTCTCCCACTACCTTTACTTCAAGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.50%	0.06%	0.00%	NA
All Indica	2759	96.80%	3.10%	0.07%	0.00%	NA
All Japonica	1512	7.50%	92.50%	0.00%	0.00%	NA
Aus	269	16.70%	83.30%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.00%	2.80%	0.22%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.90%	5.00%	0.13%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	6.20%	93.80%	0.00%	0.00%	NA
Japonica Intermediate	241	32.40%	67.60%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321319909	C -> T	LOC_Os03g38400.1	upstream_gene_variant ; 4146.0bp to feature; MODIFIER	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0321319909	C -> T	LOC_Os03g38410.1	downstream_gene_variant ; 1338.0bp to feature; MODIFIER	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0321319909	C -> T	LOC_Os03g38400-LOC_Os03g38410	intergenic_region ; MODIFIER	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321319909	NA	1.65E-14	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	6.65E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	2.43E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	7.33E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	8.92E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	8.43E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	2.59E-33	mr1638	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	9.80E-08	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.19E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.50E-34	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.55E-36	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	7.63E-37	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	5.30E-23	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	4.10E-22	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.68E-26	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.62E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	4.72E-37	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	3.82E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	2.51E-06	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321319909	NA	1.87E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251