\
| Variant ID: vg0321293433 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21293433 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 304. )
TTCCTGATCTGTTATGCAACTATGCCTGGCATCTTTTCTGACATGTTCAAGGCATTTGTAGATAGGGACTAGTGCAACACATGGTTTCAGGTGTGGTTAT[C/T]
TCCATGGCAGTGTAGAATGGCATGGAATGTTTGTTCATCAATATGTTTCGTGATATGGTGTGGGTTCGTGTATATCTTGCTTGCTTGCTCTCGGAAGTCT
AGACTTCCGAGAGCAAGCAAGCAAGATATACACGAACCCACACCATATCACGAAACATATTGATGAACAAACATTCCATGCCATTCTACACTGCCATGGA[G/A]
ATAACCACACCTGAAACCATGTGTTGCACTAGTCCCTATCTACAAATGCCTTGAACATGTCAGAAAAGATGCCAGGCATAGTTGCATAACAGATCAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.20% | 75.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321293433 | C -> T | LOC_Os03g38359.1 | downstream_gene_variant ; 4309.0bp to feature; MODIFIER | silent_mutation | Average:64.776; most accessible tissue: Callus, score: 93.632 | N | N | N | N |
| vg0321293433 | C -> T | LOC_Os03g38359-LOC_Os03g38370 | intergenic_region ; MODIFIER | silent_mutation | Average:64.776; most accessible tissue: Callus, score: 93.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321293433 | 3.41E-07 | NA | mr1116 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | 2.17E-07 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | 8.36E-06 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | 9.59E-07 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | 5.03E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | 2.11E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | NA | 6.18E-27 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321293433 | NA | 1.03E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |