\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321242105:

Variant ID: vg0321242105 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21242105
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TATGGTGGAAAACACAGGTTACAAAGGAAAGATGGAACTTGTCGAATCCGGCGAGATTGTAGTCGAGTTGATTCGACTAGCTCTTGACGACGTGGCCCCT[C/T]
GCAGGCTCCGGCTTCGTAGGCTGTGTGGGTTGTGTTGGCTCTGAGATTCGATCCTCTATGCCCTCCCCAGGGGTCCCTTTTATATCGCAGGTCTGGTGGT

Reverse complement sequence

ACCACCAGACCTGCGATATAAAAGGGACCCCTGGGGAGGGCATAGAGGATCGAATCTCAGAGCCAACACAACCCACACAGCCTACGAAGCCGGAGCCTGC[G/A]
AGGGGCCACGTCGTCAAGAGCTAGTCGAATCAACTCGACTACAATCTCGCCGGATTCGACAAGTTCCATCTTTCCTTTGTAACCTGTGTTTTCCACCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 44.10% 0.23% 0.04% NA
All Indica  2759 93.30% 6.40% 0.29% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 0.40% 99.30% 0.37% 0.00% NA
Indica I  595 94.50% 4.70% 0.84% 0.00% NA
Indica II  465 95.90% 3.70% 0.43% 0.00% NA
Indica III  913 94.50% 5.40% 0.11% 0.00% NA
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 44.40% 51.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321242105 C -> T LOC_Os03g38260.1 upstream_gene_variant ; 1243.0bp to feature; MODIFIER silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0321242105 C -> T LOC_Os03g38270.1 upstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0321242105 C -> T LOC_Os03g38250.1 downstream_gene_variant ; 4169.0bp to feature; MODIFIER silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0321242105 C -> T LOC_Os03g38284.1 downstream_gene_variant ; 4310.0bp to feature; MODIFIER silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0321242105 C -> T LOC_Os03g38260-LOC_Os03g38270 intergenic_region ; MODIFIER silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0321242105 C -> DEL N N silent_mutation Average:66.91; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0321242105 C T -0.01 -0.01 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321242105 NA 4.43E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.02E-48 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 3.71E-47 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 4.39E-42 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.72E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 6.62E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 1.42E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.88E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 4.01E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 7.90E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.74E-57 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 1.48E-10 6.23E-90 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 4.36E-11 3.49E-18 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 3.42E-39 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.58E-33 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 1.10E-14 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 5.95E-18 3.76E-35 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 5.14E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 5.93E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 9.95E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 3.24E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 7.84E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 3.74E-10 3.74E-10 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.65E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.82E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 1.50E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 3.42E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 3.20E-13 3.23E-109 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 6.23E-12 3.83E-22 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 1.73E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 4.34E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 2.88E-43 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 1.61E-19 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 9.07E-25 1.64E-45 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 7.90E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 5.36E-32 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 3.63E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 NA 1.46E-97 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321242105 3.33E-07 1.42E-10 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251