\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321155759:

Variant ID: vg0321155759 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21155759
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCCTGCAAATGAAACTGGGAGGATTCCGGGGCAACCCTACTCCTCCATTGAAAATGTTAAGGCGATCACGACAAGGGGAGGTAAGTCCACTCGTGATC[C/T]
ACCGTATCCTAACCCTGCCGGAACTAATGGGATGTCAAAAGAAACGCCATCTAATGACTCGGCTGACAAGGAGATTCAGCCAGAAAAGACAGTGCCACAG

Reverse complement sequence

CTGTGGCACTGTCTTTTCTGGCTGAATCTCCTTGTCAGCCGAGTCATTAGATGGCGTTTCTTTTGACATCCCATTAGTTCCGGCAGGGTTAGGATACGGT[G/A]
GATCACGAGTGGACTTACCTCCCCTTGTCGTGATCGCCTTAACATTTTCAATGGAGGAGTAGGGTTGCCCCGGAATCCTCCCAGTTTCATTTGCAGGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 18.50% 13.65% 18.07% NA
All Indica  2759 39.80% 22.00% 16.09% 22.11% NA
All Japonica  1512 72.90% 0.10% 12.10% 14.88% NA
Aus  269 4.50% 94.40% 1.12% 0.00% NA
Indica I  595 14.60% 71.10% 11.26% 3.03% NA
Indica II  465 48.20% 4.70% 22.15% 24.95% NA
Indica III  913 45.70% 4.60% 14.90% 34.83% NA
Indica Intermediate  786 47.20% 15.10% 17.56% 20.10% NA
Temperate Japonica  767 74.10% 0.00% 14.73% 11.21% NA
Tropical Japonica  504 73.80% 0.00% 7.34% 18.85% NA
Japonica Intermediate  241 67.60% 0.40% 13.69% 18.26% NA
VI/Aromatic  96 85.40% 3.10% 3.12% 8.33% NA
Intermediate  90 62.20% 12.20% 13.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321155759 C -> T LOC_Os03g38100.1 missense_variant ; p.Pro238Leu; MODERATE nonsynonymous_codon ; P238L Average:47.306; most accessible tissue: Minghui63 flag leaf, score: 70.17 benign 1.47 TOLERATED 0.24
vg0321155759 C -> DEL LOC_Os03g38100.1 N frameshift_variant Average:47.306; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321155759 NA 1.11E-15 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321155759 NA 7.50E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321155759 NA 1.56E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.64E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 5.02E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 4.18E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 4.92E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.09E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.30E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 4.22E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 6.04E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.89E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 1.87E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.39E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 3.73E-08 mr1367 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 2.09E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 6.25E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 6.01E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 8.89E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 5.32E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 7.14E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 3.10E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 5.13E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 3.07E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 7.09E-06 mr1831 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 6.03E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 5.65E-07 mr1847 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 4.81E-09 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 5.85E-07 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 3.28E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 4.44E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 1.10E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321155759 NA 7.32E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251