\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321134351:

Variant ID: vg0321134351 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21134351
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AAACAAAAAGAGGACGAGGAAGTATGTCTGCTGAAAAAGACACTCGGCCAAGCTACTCGCCTTGTAAATGTAAGTCTCCCTATACACGGCTTCAATCATC[C/T]
TGTCAGCTACTTTGCTTAGATACAGATAAATTTGTGGTGCAGAGAATCCATCTCAGGAATGAGGCGAAGACCGCAACTCTTGAAAAATTAGTTCCCTAGC

Reverse complement sequence

GCTAGGGAACTAATTTTTCAAGAGTTGCGGTCTTCGCCTCATTCCTGAGATGGATTCTCTGCACCACAAATTTATCTGTATCTAAGCAAAGTAGCTGACA[G/A]
GATGATTGAAGCCGTGTATAGGGAGACTTACATTTACAAGGCGAGTAGCTTGGCCGAGTGTCTTTTTCAGCAGACATACTTCCTCGTCCTCTTTTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 35.80% 0.08% 0.11% NA
All Indica  2759 97.60% 2.30% 0.07% 0.04% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 98.70% 0.80% 0.34% 0.17% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 47.80% 45.60% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321134351 C -> T LOC_Os03g38076.1 downstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:38.162; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0321134351 C -> T LOC_Os03g38082.1 downstream_gene_variant ; 4606.0bp to feature; MODIFIER silent_mutation Average:38.162; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0321134351 C -> T LOC_Os03g38070.1 intron_variant ; MODIFIER silent_mutation Average:38.162; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N
vg0321134351 C -> DEL N N silent_mutation Average:38.162; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321134351 1.16E-16 3.23E-102 mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 2.00E-21 2.65E-157 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 6.84E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 2.21E-107 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 2.21E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 6.39E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 2.16E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 1.36E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 1.51E-79 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 3.08E-38 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 6.82E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 7.63E-22 1.94E-150 mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 2.84E-48 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 3.94E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 2.57E-31 1.59E-210 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 8.81E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 NA 4.36E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321134351 1.29E-06 NA mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251