| Variant ID: vg0321132765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21132765 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCTTTTCTGGGGATTAGGCCGCATTTCGCTCTATTCCGCCGTATCTTCTTCCTCAAACCCCAGCCAAACAAAAGCAAACCATGCGTAGTTGGGGCAGCC[A/G]
TATTTCAACTGAGGGGAACCTTGAGCCAAAAATATTTCTCCATGCCTTTTAAAACTTCAAATAAGGGTTGGCATGCAAATTGGTTTTATGTGCAAAATCC
GGATTTTGCACATAAAACCAATTTGCATGCCAACCCTTATTTGAAGTTTTAAAAGGCATGGAGAAATATTTTTGGCTCAAGGTTCCCCTCAGTTGAAATA[T/C]
GGCTGCCCCAACTACGCATGGTTTGCTTTTGTTTGGCTGGGGTTTGAGGAAGAAGATACGGCGGAATAGAGCGAAATGCGGCCTAATCCCCAGAAAAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 36.50% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 95.70% | 3.60% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.30% | 1.18% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 5.60% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321132765 | A -> G | LOC_Os03g38076.1 | downstream_gene_variant ; 2880.0bp to feature; MODIFIER | silent_mutation | Average:43.419; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0321132765 | A -> G | LOC_Os03g38070.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.419; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321132765 | NA | 1.32E-19 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 1.42E-07 | 4.24E-77 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | NA | 2.87E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 2.36E-12 | 6.11E-128 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 7.80E-08 | 2.78E-14 | mr1750 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 2.28E-07 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 1.32E-12 | 4.36E-157 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321132765 | 1.99E-08 | 7.56E-19 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |