\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320944374:

Variant ID: vg0320944374 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20944374
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTCCACGTCACCATGAGTAAATATTTTATTAGAGTAATTTTTTTACTCATGAGTAAATCTGCCAGTCTATTATTCGATCAACGGTAGTCTCTAGGTTT[T/C]
CACTACATATGTGGTTTTCGCCACATATTTTCCCCAAAAAGAGTGACAAATTACGCAGGAATGTTGAATTAAGATGAACCGACAACAAGCTTAAGTTAAC

Reverse complement sequence

GTTAACTTAAGCTTGTTGTCGGTTCATCTTAATTCAACATTCCTGCGTAATTTGTCACTCTTTTTGGGGAAAATATGTGGCGAAAACCACATATGTAGTG[A/G]
AAACCTAGAGACTACCGTTGATCGAATAATAGACTGGCAGATTTACTCATGAGTAAAAAAATTACTCTAATAAAATATTTACTCATGGTGACGTGGACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.70% 0.13% 0.00% NA
All Indica  2759 97.50% 2.40% 0.18% 0.00% NA
All Japonica  1512 3.50% 96.50% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 95.30% 4.50% 0.25% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 9.50% 90.50% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320944374 T -> C LOC_Os03g37770.1 downstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0320944374 T -> C LOC_Os03g37780.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0320944374 T -> C LOC_Os03g37770-LOC_Os03g37780 intergenic_region ; MODIFIER silent_mutation Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320944374 NA 5.25E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320944374 2.56E-06 4.04E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320944374 3.68E-09 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320944374 4.60E-11 3.91E-19 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320944374 NA 4.51E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320944374 2.65E-06 1.85E-21 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251