| Variant ID: vg0320944374 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20944374 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGTCCACGTCACCATGAGTAAATATTTTATTAGAGTAATTTTTTTACTCATGAGTAAATCTGCCAGTCTATTATTCGATCAACGGTAGTCTCTAGGTTT[T/C]
CACTACATATGTGGTTTTCGCCACATATTTTCCCCAAAAAGAGTGACAAATTACGCAGGAATGTTGAATTAAGATGAACCGACAACAAGCTTAAGTTAAC
GTTAACTTAAGCTTGTTGTCGGTTCATCTTAATTCAACATTCCTGCGTAATTTGTCACTCTTTTTGGGGAAAATATGTGGCGAAAACCACATATGTAGTG[A/G]
AAACCTAGAGACTACCGTTGATCGAATAATAGACTGGCAGATTTACTCATGAGTAAAAAAATTACTCTAATAAAATATTTACTCATGGTGACGTGGACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 35.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.50% | 90.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320944374 | T -> C | LOC_Os03g37770.1 | downstream_gene_variant ; 3918.0bp to feature; MODIFIER | silent_mutation | Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0320944374 | T -> C | LOC_Os03g37780.1 | downstream_gene_variant ; 654.0bp to feature; MODIFIER | silent_mutation | Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0320944374 | T -> C | LOC_Os03g37770-LOC_Os03g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:50.7; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320944374 | NA | 5.25E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320944374 | 2.56E-06 | 4.04E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320944374 | 3.68E-09 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320944374 | 4.60E-11 | 3.91E-19 | mr1750 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320944374 | NA | 4.51E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320944374 | 2.65E-06 | 1.85E-21 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |