\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320905869:

Variant ID: vg0320905869 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20905869
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTGACAGGACCCTTCGCATAACTCCCTCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCCCAGCGGGCAACGGGCAGTCCCCTCTCGTGCCTA[A/G]
GTGAATCCGGAAGCGACAGAGGCCGTCGTAGGGCCCGCCCCGCTCCATCACGCCTACCCTTGTCTGGATGCGTCAACTAGAGGAAAGCTACACTACAAGC

Reverse complement sequence

GCTTGTAGTGTAGCTTTCCTCTAGTTGACGCATCCAGACAAGGGTAGGCGTGATGGAGCGGGGCGGGCCCTACGACGGCCTCTGTCGCTTCCGGATTCAC[T/C]
TAGGCACGAGAGGGGACTGCCCGTTGCCCGCTGGGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGAGGGAGTTATGCGAAGGGTCCTGTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 32.90% 16.19% 12.78% NA
All Indica  2759 53.90% 3.30% 22.58% 20.30% NA
All Japonica  1512 12.10% 87.40% 0.46% 0.07% NA
Aus  269 36.40% 11.20% 40.89% 11.52% NA
Indica I  595 48.60% 1.80% 30.42% 19.16% NA
Indica II  465 60.40% 3.70% 23.87% 12.04% NA
Indica III  913 56.50% 2.20% 16.32% 24.97% NA
Indica Intermediate  786 50.90% 5.30% 23.16% 20.61% NA
Temperate Japonica  767 0.10% 99.60% 0.26% 0.00% NA
Tropical Japonica  504 32.70% 66.50% 0.60% 0.20% NA
Japonica Intermediate  241 7.10% 92.10% 0.83% 0.00% NA
VI/Aromatic  96 8.30% 75.00% 15.62% 1.04% NA
Intermediate  90 27.80% 48.90% 11.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320905869 A -> DEL N N silent_mutation Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg0320905869 A -> G LOC_Os03g37700.1 upstream_gene_variant ; 987.0bp to feature; MODIFIER silent_mutation Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg0320905869 A -> G LOC_Os03g37690.1 downstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg0320905869 A -> G LOC_Os03g37710.1 downstream_gene_variant ; 3460.0bp to feature; MODIFIER silent_mutation Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg0320905869 A -> G LOC_Os03g37690-LOC_Os03g37700 intergenic_region ; MODIFIER silent_mutation Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320905869 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 7.28E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 5.25E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 3.94E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 4.02E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 9.39E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 3.27E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 3.67E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 6.35E-08 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 6.43E-09 7.78E-21 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 6.47E-07 6.47E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 5.64E-09 1.13E-27 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869 NA 4.75E-08 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251