Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320905869:

Variant ID: vg0320905869 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20905869
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTGACAGGACCCTTCGCATAACTCCCTCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCCCAGCGGGCAACGGGCAGTCCCCTCTCGTGCCTA[A/G]
GTGAATCCGGAAGCGACAGAGGCCGTCGTAGGGCCCGCCCCGCTCCATCACGCCTACCCTTGTCTGGATGCGTCAACTAGAGGAAAGCTACACTACAAGC

Reverse complement sequence

GCTTGTAGTGTAGCTTTCCTCTAGTTGACGCATCCAGACAAGGGTAGGCGTGATGGAGCGGGGCGGGCCCTACGACGGCCTCTGTCGCTTCCGGATTCAC[T/C]
TAGGCACGAGAGGGGACTGCCCGTTGCCCGCTGGGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGAGGGAGTTATGCGAAGGGTCCTGTCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.10%	32.90%	16.19%	12.78%	NA
All Indica	2759	53.90%	3.30%	22.58%	20.30%	NA
All Japonica	1512	12.10%	87.40%	0.46%	0.07%	NA
Aus	269	36.40%	11.20%	40.89%	11.52%	NA
Indica I	595	48.60%	1.80%	30.42%	19.16%	NA
Indica II	465	60.40%	3.70%	23.87%	12.04%	NA
Indica III	913	56.50%	2.20%	16.32%	24.97%	NA
Indica Intermediate	786	50.90%	5.30%	23.16%	20.61%	NA
Temperate Japonica	767	0.10%	99.60%	0.26%	0.00%	NA
Tropical Japonica	504	32.70%	66.50%	0.60%	0.20%	NA
Japonica Intermediate	241	7.10%	92.10%	0.83%	0.00%	NA
VI/Aromatic	96	8.30%	75.00%	15.62%	1.04%	NA
Intermediate	90	27.80%	48.90%	11.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320905869	A -> DEL	N	N	silent_mutation	Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N
vg0320905869	A -> G	LOC_Os03g37700.1	upstream_gene_variant ; 987.0bp to feature; MODIFIER	silent_mutation	Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N
vg0320905869	A -> G	LOC_Os03g37690.1	downstream_gene_variant ; 3002.0bp to feature; MODIFIER	silent_mutation	Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N
vg0320905869	A -> G	LOC_Os03g37710.1	downstream_gene_variant ; 3460.0bp to feature; MODIFIER	silent_mutation	Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N
vg0320905869	A -> G	LOC_Os03g37690-LOC_Os03g37700	intergenic_region ; MODIFIER	silent_mutation	Average:22.21; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320905869	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	7.28E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	5.25E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	3.94E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	4.02E-07	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	9.39E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	3.27E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	3.67E-06	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	6.35E-08	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	6.43E-09	7.78E-21	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	7.10E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	6.47E-07	6.47E-07	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	5.64E-09	1.13E-27	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320905869	NA	4.75E-08	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251