\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320827730:

Variant ID: vg0320827730 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20827730
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTTTCGCCACCAATCGTGCCTTGTAGATGTGAACATTTCCATCTACATCTGTCTTTTTCTTAAAGAACCATTTGCACTCAATGGCTTTTACACCATCA[A/G]
GTGGATCAACCAAGTTTCAAACTTGATTGACATGCATGGATTCTATTTCGGATTTCATAGCTCCAAGCCATTTCTCAGAGTCTGGTCCCACCATTGCTTC

Reverse complement sequence

GAAGCAATGGTGGGACCAGACTCTGAGAAATGGCTTGGAGCTATGAAATCCGAAATAGAATCCATGCATGTCAATCAAGTTTGAAACTTGGTTGATCCAC[T/C]
TGATGGTGTAAAAGCCATTGAGTGCAAATGGTTCTTTAAGAAAAAGACAGATGTAGATGGAAATGTTCACATCTACAAGGCACGATTGGTGGCGAAAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 32.60% 0.80% 0.00% NA
All Indica  2759 95.30% 3.40% 1.23% 0.00% NA
All Japonica  1512 14.10% 85.90% 0.00% 0.00% NA
Aus  269 88.50% 11.20% 0.37% 0.00% NA
Indica I  595 95.60% 3.50% 0.84% 0.00% NA
Indica II  465 93.50% 3.90% 2.58% 0.00% NA
Indica III  913 97.40% 1.90% 0.77% 0.00% NA
Indica Intermediate  786 93.80% 5.00% 1.27% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 33.70% 66.30% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320827730 A -> G LOC_Os03g37540.1 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:21.384; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N
vg0320827730 A -> G LOC_Os03g37554.1 intron_variant ; MODIFIER silent_mutation Average:21.384; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320827730 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 4.07E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 9.38E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 1.24E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 1.25E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 1.83E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 6.28E-08 2.65E-15 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 1.24E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 5.39E-06 NA mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320827730 7.05E-06 1.39E-20 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251