| Variant ID: vg0320740955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20740955 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCGTGATGCAAAGGGGTTCATACAAGTATAAACTAGTGGTTCATCTGATATGATCTTTATGTATGCCCGGTGGGTCAATACGTTCTGCTAGAGGCCGCT[A/G]
TTGACGCGTGGACCGAAAAGGAGTTTTCGGGTTACAGCCGAGTATATATGAACCTACAGGGTTGCACGCTTAATGGGCCGAAATAAGGCGATTGGATGGA
TCCATCCAATCGCCTTATTTCGGCCCATTAAGCGTGCAACCCTGTAGGTTCATATATACTCGGCTGTAACCCGAAAACTCCTTTTCGGTCCACGCGTCAA[T/C]
AGCGGCCTCTAGCAGAACGTATTGACCCACCGGGCATACATAAAGATCATATCAGATGAACCACTAGTTTATACTTGTATGAACCCCTTTGCATCACGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 13.80% | 5.97% | 0.78% | NA |
| All Indica | 2759 | 98.20% | 0.80% | 0.98% | 0.04% | NA |
| All Japonica | 1512 | 48.60% | 40.50% | 10.12% | 0.73% | NA |
| Aus | 269 | 61.30% | 0.00% | 30.48% | 8.18% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.70% | 1.90% | 2.37% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.40% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 98.10% | 0.60% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 35.50% | 49.40% | 13.82% | 1.30% | NA |
| Tropical Japonica | 504 | 58.90% | 36.50% | 4.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 20.70% | 9.96% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 13.54% | 2.08% | NA |
| Intermediate | 90 | 74.40% | 16.70% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320740955 | A -> DEL | N | N | silent_mutation | Average:30.89; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0320740955 | A -> G | LOC_Os03g37411.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.89; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320740955 | NA | 4.74E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 2.56E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 3.51E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 3.14E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 1.85E-06 | mr1876 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 3.25E-06 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 7.71E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320740955 | NA | 7.60E-06 | mr1899_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |