\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320662648:

Variant ID: vg0320662648 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20662648
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACACTGTTCATCCTATAGAACTTAACGACGCGGAATGGACGGAACCCTAACGGCGATGGCATTTTTGGGACAAAATCGTTTATACGATGGCATTTTTT[A/G,T]
GAACTCACACTTGTCGATGGCATTTCTGGGACATAGACGCTTGTCATGGCATTTCATGGATTATCTCATAATATTTTAATTTTCAACTAATAAACTTTGA

Reverse complement sequence

TCAAAGTTTATTAGTTGAAAATTAAAATATTATGAGATAATCCATGAAATGCCATGACAAGCGTCTATGTCCCAGAAATGCCATCGACAAGTGTGAGTTC[T/C,A]
AAAAAATGCCATCGTATAAACGATTTTGTCCCAAAAATGCCATCGCCGTTAGGGTTCCGTCCATTCCGCGTCGTTAAGTTCTATAGGATGAACAGTGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.80% 0.34% 0.00% T: 0.04%
All Indica  2759 97.20% 2.30% 0.40% 0.00% T: 0.04%
All Japonica  1512 13.90% 85.80% 0.26% 0.00% T: 0.07%
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 97.80% 1.50% 0.67% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 98.50% 1.30% 0.11% 0.00% T: 0.11%
Indica Intermediate  786 95.40% 3.80% 0.76% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 33.30% 65.70% 0.79% 0.00% T: 0.20%
Japonica Intermediate  241 17.00% 83.00% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320662648 A -> T LOC_Os03g37270.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0320662648 A -> T LOC_Os03g37290.1 downstream_gene_variant ; 3361.0bp to feature; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0320662648 A -> T LOC_Os03g37270-LOC_Os03g37290 intergenic_region ; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0320662648 A -> G LOC_Os03g37270.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0320662648 A -> G LOC_Os03g37290.1 downstream_gene_variant ; 3361.0bp to feature; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0320662648 A -> G LOC_Os03g37270-LOC_Os03g37290 intergenic_region ; MODIFIER silent_mutation Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320662648 NA 1.79E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 5.97E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 6.24E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 5.03E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 2.25E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 2.85E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 4.06E-12 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 5.70E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 4.86E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 2.25E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 7.23E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 1.30E-08 9.43E-20 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 NA 1.85E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320662648 4.73E-06 3.55E-08 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251