\
| Variant ID: vg0320662648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20662648 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAACACTGTTCATCCTATAGAACTTAACGACGCGGAATGGACGGAACCCTAACGGCGATGGCATTTTTGGGACAAAATCGTTTATACGATGGCATTTTTT[A/G,T]
GAACTCACACTTGTCGATGGCATTTCTGGGACATAGACGCTTGTCATGGCATTTCATGGATTATCTCATAATATTTTAATTTTCAACTAATAAACTTTGA
TCAAAGTTTATTAGTTGAAAATTAAAATATTATGAGATAATCCATGAAATGCCATGACAAGCGTCTATGTCCCAGAAATGCCATCGACAAGTGTGAGTTC[T/C,A]
AAAAAATGCCATCGTATAAACGATTTTGTCCCAAAAATGCCATCGCCGTTAGGGTTCCGTCCATTCCGCGTCGTTAAGTTCTATAGGATGAACAGTGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 31.80% | 0.34% | 0.00% | T: 0.04% |
| All Indica | 2759 | 97.20% | 2.30% | 0.40% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 13.90% | 85.80% | 0.26% | 0.00% | T: 0.07% |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.30% | 0.11% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 95.40% | 3.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.30% | 65.70% | 0.79% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 17.00% | 83.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320662648 | A -> T | LOC_Os03g37270.1 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0320662648 | A -> T | LOC_Os03g37290.1 | downstream_gene_variant ; 3361.0bp to feature; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0320662648 | A -> T | LOC_Os03g37270-LOC_Os03g37290 | intergenic_region ; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0320662648 | A -> G | LOC_Os03g37270.1 | upstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0320662648 | A -> G | LOC_Os03g37290.1 | downstream_gene_variant ; 3361.0bp to feature; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0320662648 | A -> G | LOC_Os03g37270-LOC_Os03g37290 | intergenic_region ; MODIFIER | silent_mutation | Average:29.024; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320662648 | NA | 1.79E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 5.97E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 6.24E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 5.03E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 2.25E-17 | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 2.85E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 4.06E-12 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 5.70E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 4.86E-11 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 2.25E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | 7.23E-07 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | 1.30E-08 | 9.43E-20 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | NA | 1.85E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320662648 | 4.73E-06 | 3.55E-08 | mr1987_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |