\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320619051:

Variant ID: vg0320619051 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20619051
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGGGTAGAATTCTAGTATACACAAAAATATGAAGATGCACTTAAACCCCCAAGTGGGTTTTGGTGATTAATGACAAGGTGGTTAAAGGGGACTAAC[G/A]
TGTTTATCAAGTTTATTCACAGGAGTTTAGTCCCAAAGCGAGTTGTGATGGCTAAGAATGCAAGGAGACCCCCCAATTCAAATGTTCCTAAGTGCAAAAA

Reverse complement sequence

TTTTTGCACTTAGGAACATTTGAATTGGGGGGTCTCCTTGCATTCTTAGCCATCACAACTCGCTTTGGGACTAAACTCCTGTGAATAAACTTGATAAACA[C/T]
GTTAGTCCCCTTTAACCACCTTGTCATTAATCACCAAAACCCACTTGGGGGTTTAAGTGCATCTTCATATTTTTGTGTATACTAGAATTCTACCCCTCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 31.50% 0.15% 0.61% NA
All Indica  2759 97.70% 2.10% 0.00% 0.25% NA
All Japonica  1512 13.10% 85.10% 0.33% 1.46% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.00% 0.11% NA
Indica Intermediate  786 95.80% 3.60% 0.00% 0.64% NA
Temperate Japonica  767 0.80% 98.60% 0.65% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.90% 83.40% 0.00% 8.71% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320619051 G -> A LOC_Os03g37210.1 upstream_gene_variant ; 1414.0bp to feature; MODIFIER silent_mutation Average:53.532; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg0320619051 G -> A LOC_Os03g37194-LOC_Os03g37210 intergenic_region ; MODIFIER silent_mutation Average:53.532; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg0320619051 G -> DEL N N silent_mutation Average:53.532; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320619051 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 3.84E-12 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 5.38E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 4.13E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.72E-33 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.93E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 1.09E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 3.15E-10 4.91E-20 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.40E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 1.31E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 2.23E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 9.72E-08 1.15E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 7.64E-07 5.42E-22 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320619051 NA 2.28E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251