\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320463339:

Variant ID: vg0320463339 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20463339
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGTGGAGTCGTCTGCGCCGTTTATCTTATTTTTTTTTCACTGCTTAGATCTTTATTGATTGAGAGGAACTATCTGCCTATGTAATGACATTTTATTC[A/G]
CTTATTAATTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAA

Reverse complement sequence

TTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAATTAATAAG[T/C]
GAATAAAATGTCATTACATAGGCAGATAGTTCCTCTCAATCAATAAAGATCTAAGCAGTGAAAAAAAAATAAGATAAACGGCGCAGACGACTCCACTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 33.40% 2.54% 0.00% NA
All Indica  2759 96.20% 3.40% 0.40% 0.00% NA
All Japonica  1512 12.60% 87.30% 0.13% 0.00% NA
Aus  269 47.20% 15.60% 37.17% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 97.70% 1.90% 0.44% 0.00% NA
Indica Intermediate  786 93.30% 6.20% 0.51% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 65.90% 0.20% 0.00% NA
Japonica Intermediate  241 7.10% 92.50% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 77.10% 6.25% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320463339 A -> G LOC_Os03g36870.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0320463339 A -> G LOC_Os03g36890.1 downstream_gene_variant ; 3206.0bp to feature; MODIFIER silent_mutation Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0320463339 A -> G LOC_Os03g36880.1 intron_variant ; MODIFIER silent_mutation Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320463339 NA 5.45E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 4.60E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 2.28E-07 mr1321 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 2.43E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 6.51E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 6.17E-06 NA mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 4.06E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 1.69E-06 9.54E-06 mr1444 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 1.77E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 8.19E-06 2.78E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339 NA 1.84E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251