Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320463339:

Variant ID: vg0320463339 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20463339
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAGTGGAGTCGTCTGCGCCGTTTATCTTATTTTTTTTTCACTGCTTAGATCTTTATTGATTGAGAGGAACTATCTGCCTATGTAATGACATTTTATTC[A/G]
CTTATTAATTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAA

Reverse complement sequence

TTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAATTAATAAG[T/C]
GAATAAAATGTCATTACATAGGCAGATAGTTCCTCTCAATCAATAAAGATCTAAGCAGTGAAAAAAAAATAAGATAAACGGCGCAGACGACTCCACTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	33.40%	2.54%	0.00%	NA
All Indica	2759	96.20%	3.40%	0.40%	0.00%	NA
All Japonica	1512	12.60%	87.30%	0.13%	0.00%	NA
Aus	269	47.20%	15.60%	37.17%	0.00%	NA
Indica I	595	97.80%	1.80%	0.34%	0.00%	NA
Indica II	465	96.30%	3.40%	0.22%	0.00%	NA
Indica III	913	97.70%	1.90%	0.44%	0.00%	NA
Indica Intermediate	786	93.30%	6.20%	0.51%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	33.90%	65.90%	0.20%	0.00%	NA
Japonica Intermediate	241	7.10%	92.50%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	77.10%	6.25%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320463339	A -> G	LOC_Os03g36870.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0320463339	A -> G	LOC_Os03g36890.1	downstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0320463339	A -> G	LOC_Os03g36880.1	intron_variant ; MODIFIER	silent_mutation	Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320463339	NA	5.45E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	4.60E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	2.28E-07	mr1321	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	2.43E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	6.51E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	6.17E-06	NA	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	4.06E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	1.69E-06	9.54E-06	mr1444	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	1.77E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	8.19E-06	2.78E-06	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320463339	NA	1.84E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251