\
| Variant ID: vg0320463339 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20463339 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 49. )
TGGAGTGGAGTCGTCTGCGCCGTTTATCTTATTTTTTTTTCACTGCTTAGATCTTTATTGATTGAGAGGAACTATCTGCCTATGTAATGACATTTTATTC[A/G]
CTTATTAATTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAA
TTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAATTAATAAG[T/C]
GAATAAAATGTCATTACATAGGCAGATAGTTCCTCTCAATCAATAAAGATCTAAGCAGTGAAAAAAAAATAAGATAAACGGCGCAGACGACTCCACTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 33.40% | 2.54% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 12.60% | 87.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 47.20% | 15.60% | 37.17% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.70% | 1.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.90% | 65.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 77.10% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320463339 | A -> G | LOC_Os03g36870.1 | downstream_gene_variant ; 4486.0bp to feature; MODIFIER | silent_mutation | Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0320463339 | A -> G | LOC_Os03g36890.1 | downstream_gene_variant ; 3206.0bp to feature; MODIFIER | silent_mutation | Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0320463339 | A -> G | LOC_Os03g36880.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.322; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320463339 | NA | 5.45E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 4.60E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 2.28E-07 | mr1321 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 2.43E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 6.51E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | 6.17E-06 | NA | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 4.06E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | 1.69E-06 | 9.54E-06 | mr1444 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 1.77E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | 8.19E-06 | 2.78E-06 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320463339 | NA | 1.84E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |