Variant ID: vg0320217493 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 20217493 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 61. )
TTGATTTTAATATCTTGTGCATAAATATTCGTAGGGTTAAATATATTCTTGTAAATTATATCTATTGCTTAAATGTCGATCTTTTCTTTACTTTCTTTGT[G/A]
ATCATTTACGGTTTGGCAAGCCATAGCAATCATAACAACCAGCATGCTGCAAAAGTTTTAAAAAGTTCGAAATTTTAGTAATTTTTATTGTGAGGAATTT
AAATTCCTCACAATAAAAATTACTAAAATTTCGAACTTTTTAAAACTTTTGCAGCATGCTGGTTGTTATGATTGCTATGGCTTGCCAAACCGTAAATGAT[C/T]
ACAAAGAAAGTAAAGAAAAGATCGACATTTAAGCAATAGATATAATTTACAAGAATATATTTAACCCTACGAATATTTATGCACAAGATATTAAAATCAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.70% | 14.30% | 0.38% | 0.61% | NA |
All Indica | 2759 | 81.00% | 18.30% | 0.58% | 0.11% | NA |
All Japonica | 1512 | 87.40% | 10.90% | 0.13% | 1.52% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 94.30% | 5.20% | 0.50% | 0.00% | NA |
Indica II | 465 | 77.00% | 21.30% | 1.72% | 0.00% | NA |
Indica III | 913 | 71.50% | 28.10% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 84.40% | 15.00% | 0.25% | 0.38% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 69.80% | 29.80% | 0.20% | 0.20% | NA |
Japonica Intermediate | 241 | 84.20% | 6.20% | 0.41% | 9.13% | NA |
VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0320217493 | G -> A | LOC_Os03g36520.1 | upstream_gene_variant ; 4020.0bp to feature; MODIFIER | silent_mutation | Average:42.723; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
vg0320217493 | G -> A | LOC_Os03g36500.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.723; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
vg0320217493 | G -> DEL | N | N | silent_mutation | Average:42.723; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0320217493 | NA | 1.93E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | 3.87E-06 | NA | mr1362 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | 3.60E-07 | 3.06E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | NA | 4.32E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | 2.78E-06 | 6.41E-09 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | NA | 9.33E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | NA | 5.80E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0320217493 | NA | 9.53E-07 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |