\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320096298:

Variant ID: vg0320096298 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20096298
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGATTCGGCCCATCAAACCCGAGGGAGGCGAATCAGACTTTTGCGGAGGGATTGATTTGGGAAGGATTTGGATTCGGGATTGAACTTGACGATAGATC[A/G]
GGGATTTGAGATCTGAGATGGCACGGACACTAGACAACAAGCAAAGAAACGGATTTCGCAAATAGGGTTTTTAAGAGATAGTTTTCCCGCTAGGCGCCAC

Reverse complement sequence

GTGGCGCCTAGCGGGAAAACTATCTCTTAAAAACCCTATTTGCGAAATCCGTTTCTTTGCTTGTTGTCTAGTGTCCGTGCCATCTCAGATCTCAAATCCC[T/C]
GATCTATCGTCAAGTTCAATCCCGAATCCAAATCCTTCCCAAATCAATCCCTCCGCAAAAGTCTGATTCGCCTCCCTCGGGTTTGATGGGCCGAATCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 32.10% 7.55% 0.08% NA
All Indica  2759 89.90% 2.80% 7.29% 0.07% NA
All Japonica  1512 4.10% 86.00% 9.79% 0.13% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 77.60% 2.50% 19.83% 0.00% NA
Indica II  465 90.10% 3.00% 6.45% 0.43% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 89.10% 4.50% 6.49% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 9.90% 66.10% 23.61% 0.40% NA
Japonica Intermediate  241 3.70% 84.20% 12.03% 0.00% NA
VI/Aromatic  96 25.00% 71.90% 3.12% 0.00% NA
Intermediate  90 43.30% 51.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320096298 A -> DEL N N silent_mutation Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0320096298 A -> G LOC_Os03g36220.1 upstream_gene_variant ; 3392.0bp to feature; MODIFIER silent_mutation Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0320096298 A -> G LOC_Os03g36239.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0320096298 A -> G LOC_Os03g36220-LOC_Os03g36239 intergenic_region ; MODIFIER silent_mutation Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320096298 NA 1.47E-09 mr1785 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320096298 NA 8.51E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320096298 NA 5.01E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320096298 NA 5.23E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320096298 NA 4.88E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320096298 NA 3.40E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251