\
| Variant ID: vg0320096298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20096298 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGGATTCGGCCCATCAAACCCGAGGGAGGCGAATCAGACTTTTGCGGAGGGATTGATTTGGGAAGGATTTGGATTCGGGATTGAACTTGACGATAGATC[A/G]
GGGATTTGAGATCTGAGATGGCACGGACACTAGACAACAAGCAAAGAAACGGATTTCGCAAATAGGGTTTTTAAGAGATAGTTTTCCCGCTAGGCGCCAC
GTGGCGCCTAGCGGGAAAACTATCTCTTAAAAACCCTATTTGCGAAATCCGTTTCTTTGCTTGTTGTCTAGTGTCCGTGCCATCTCAGATCTCAAATCCC[T/C]
GATCTATCGTCAAGTTCAATCCCGAATCCAAATCCTTCCCAAATCAATCCCTCCGCAAAAGTCTGATTCGCCTCCCTCGGGTTTGATGGGCCGAATCCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.20% | 32.10% | 7.55% | 0.08% | NA |
| All Indica | 2759 | 89.90% | 2.80% | 7.29% | 0.07% | NA |
| All Japonica | 1512 | 4.10% | 86.00% | 9.79% | 0.13% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.60% | 2.50% | 19.83% | 0.00% | NA |
| Indica II | 465 | 90.10% | 3.00% | 6.45% | 0.43% | NA |
| Indica III | 913 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 4.50% | 6.49% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 66.10% | 23.61% | 0.40% | NA |
| Japonica Intermediate | 241 | 3.70% | 84.20% | 12.03% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 51.10% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320096298 | A -> DEL | N | N | silent_mutation | Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0320096298 | A -> G | LOC_Os03g36220.1 | upstream_gene_variant ; 3392.0bp to feature; MODIFIER | silent_mutation | Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0320096298 | A -> G | LOC_Os03g36239.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0320096298 | A -> G | LOC_Os03g36220-LOC_Os03g36239 | intergenic_region ; MODIFIER | silent_mutation | Average:34.305; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320096298 | NA | 1.47E-09 | mr1785 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320096298 | NA | 8.51E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320096298 | NA | 5.01E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320096298 | NA | 5.23E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320096298 | NA | 4.88E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320096298 | NA | 3.40E-07 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |