| Variant ID: vg0319980220 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19980220 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AACTTGGATTTGAGCATGCATTGATCCTACTCCTCTGTCTTCTCTAGATGGCCGGCCACCCACCCAACCACCGCGGAGAAGGCATGATCGACTTTGTGGC[A/C]
GAGTTGGCACGCATGACATTGGTGGTGGGCTACCCCAACGCGCCAGAGTATACGACGATTCCACCGCTCAGTGGCGAGCTTCCTCACCGTGTTCGCTTGG
CCAAGCGAACACGGTGAGGAAGCTCGCCACTGAGCGGTGGAATCGTCGTATACTCTGGCGCGTTGGGGTAGCCCACCACCAATGTCATGCGTGCCAACTC[T/G]
GCCACAAAGTCGATCATGCCTTCTCCGCGGTGGTTGGGTGGGTGGCCGGCCATCTAGAGAAGACAGAGGAGTAGGATCAATGCATGCTCAAATCCAAGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 0.30% | 4.38% | 6.98% | NA |
| All Indica | 2759 | 86.10% | 0.50% | 6.85% | 6.60% | NA |
| All Japonica | 1512 | 89.90% | 0.00% | 0.73% | 9.33% | NA |
| Aus | 269 | 97.80% | 0.40% | 0.74% | 1.12% | NA |
| Indica I | 595 | 81.20% | 0.30% | 7.39% | 11.09% | NA |
| Indica II | 465 | 84.50% | 0.90% | 12.69% | 1.94% | NA |
| Indica III | 913 | 91.60% | 0.30% | 3.07% | 5.04% | NA |
| Indica Intermediate | 786 | 84.40% | 0.50% | 7.38% | 7.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 73.80% | 0.00% | 1.39% | 24.80% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.00% | 1.24% | 6.64% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319980220 | A -> C | LOC_Os03g36020.1 | synonymous_variant ; p.Ala18Ala; LOW | synonymous_codon | Average:8.158; most accessible tissue: Callus, score: 29.691 | N | N | N | N |
| vg0319980220 | A -> DEL | LOC_Os03g36020.1 | N | frameshift_variant | Average:8.158; most accessible tissue: Callus, score: 29.691 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319980220 | NA | 1.10E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319980220 | 3.81E-06 | 1.01E-06 | mr1043 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319980220 | NA | 5.19E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319980220 | 9.33E-07 | 1.16E-07 | mr1912 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |