\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319944599:

Variant ID: vg0319944599 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19944599
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTCGTAGTGGAACCTTGTGTCCTCTGCGGGGTTTATAGCCGTTTGACCGAGGCAATCCGCGGGTGGTGATAAGCAACGGCTTGTTTCAAAATACACTG[A/G]
TTTTCGAAAATATCTCTTTTCCCTTGTGCACTTAGGTAATCATTTTATTTTGCGGGCGAGCCGCTTTCGAAAAAAAAGGGCGGAGGAGAGGGGGGGGGAC

Reverse complement sequence

GTCCCCCCCCCTCTCCTCCGCCCTTTTTTTTCGAAAGCGGCTCGCCCGCAAAATAAAATGATTACCTAAGTGCACAAGGGAAAAGAGATATTTTCGAAAA[T/C]
CAGTGTATTTTGAAACAAGCCGTTGCTTATCACCACCCGCGGATTGCCTCGGTCAAACGGCTATAAACCCCGCAGAGGACACAAGGTTCCACTACGACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 13.50% 0.70% 0.59% NA
All Indica  2759 98.30% 1.30% 0.33% 0.14% NA
All Japonica  1512 64.80% 32.50% 1.26% 1.46% NA
Aus  269 90.00% 9.70% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 98.80% 1.00% 0.22% 0.00% NA
Indica Intermediate  786 96.40% 2.70% 0.38% 0.51% NA
Temperate Japonica  767 90.70% 8.20% 1.04% 0.00% NA
Tropical Japonica  504 42.30% 56.70% 0.79% 0.20% NA
Japonica Intermediate  241 29.50% 58.90% 2.90% 8.71% NA
VI/Aromatic  96 28.10% 69.80% 0.00% 2.08% NA
Intermediate  90 75.60% 20.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319944599 A -> DEL N N silent_mutation Average:65.754; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0319944599 A -> G LOC_Os03g35950.1 upstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:65.754; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0319944599 A -> G LOC_Os03g35940.1 downstream_gene_variant ; 4475.0bp to feature; MODIFIER silent_mutation Average:65.754; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0319944599 A -> G LOC_Os03g35940-LOC_Os03g35950 intergenic_region ; MODIFIER silent_mutation Average:65.754; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319944599 NA 3.68E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.73E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 1.34E-06 1.34E-06 mr1053 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 3.58E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 6.66E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.78E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 2.17E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 3.95E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.28E-07 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 5.41E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 4.19E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.69E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 9.01E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 3.90E-08 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.01E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 7.99E-13 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 1.06E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 4.38E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 2.88E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319944599 NA 2.83E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251