Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319910078:

Variant ID: vg0319910078 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19910078
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACGAGAAACAGCGGAAGACTAGGGCGACGACCACAGGCACTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCCTCCAGGAACTCCTCTTCTG[G/A]
GCTGGGGAAAAATTAAGCAAGATTGAGTACAACCACCTACTCAGCAAGACACACCCACGAATGCAGAATAAATGCAAAGGAGTACAAGGGAGTTATAATA

Reverse complement sequence

TATTATAACTCCCTTGTACTCCTTTGCATTTATTCTGCATTCGTGGGTGTGTCTTGCTGAGTAGGTGGTTGTACTCAATCTTGCTTAATTTTTCCCCAGC[C/T]
CAGAAGAGGAGTTCCTGGAGGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTCTCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	31.60%	0.21%	0.72%	NA
All Indica	2759	97.20%	2.50%	0.18%	0.07%	NA
All Japonica	1512	13.00%	84.90%	0.20%	1.98%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	97.00%	2.80%	0.22%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.10%	0.38%	0.25%	NA
Temperate Japonica	767	0.50%	97.40%	0.00%	2.09%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.90%	85.50%	1.24%	5.39%	NA
VI/Aromatic	96	25.00%	72.90%	0.00%	2.08%	NA
Intermediate	90	50.00%	47.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319910078	G -> A	LOC_Os03g35886.1	upstream_gene_variant ; 1521.0bp to feature; MODIFIER	silent_mutation	Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg0319910078	G -> A	LOC_Os03g35886-LOC_Os03g35894	intergenic_region ; MODIFIER	silent_mutation	Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N
vg0319910078	G -> DEL	N	N	silent_mutation	Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319910078	5.39E-07	NA	mr1079	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	9.10E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	6.18E-08	6.28E-13	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	2.76E-10	3.68E-23	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	4.61E-06	4.61E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	9.57E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	1.74E-24	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	5.42E-06	1.53E-15	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	1.40E-12	4.07E-38	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319910078	NA	2.14E-08	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251