\
| Variant ID: vg0319910078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19910078 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAACGAGAAACAGCGGAAGACTAGGGCGACGACCACAGGCACTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCCTCCAGGAACTCCTCTTCTG[G/A]
GCTGGGGAAAAATTAAGCAAGATTGAGTACAACCACCTACTCAGCAAGACACACCCACGAATGCAGAATAAATGCAAAGGAGTACAAGGGAGTTATAATA
TATTATAACTCCCTTGTACTCCTTTGCATTTATTCTGCATTCGTGGGTGTGTCTTGCTGAGTAGGTGGTTGTACTCAATCTTGCTTAATTTTTCCCCAGC[C/T]
CAGAAGAGGAGTTCCTGGAGGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTCTCGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 31.60% | 0.21% | 0.72% | NA |
| All Indica | 2759 | 97.20% | 2.50% | 0.18% | 0.07% | NA |
| All Japonica | 1512 | 13.00% | 84.90% | 0.20% | 1.98% | NA |
| Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.10% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 0.50% | 97.40% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.90% | 85.50% | 1.24% | 5.39% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 47.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319910078 | G -> A | LOC_Os03g35886.1 | upstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0319910078 | G -> A | LOC_Os03g35886-LOC_Os03g35894 | intergenic_region ; MODIFIER | silent_mutation | Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0319910078 | G -> DEL | N | N | silent_mutation | Average:49.49; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319910078 | 5.39E-07 | NA | mr1079 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 9.10E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | 6.18E-08 | 6.28E-13 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | 2.76E-10 | 3.68E-23 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | 4.61E-06 | 4.61E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 9.57E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 1.74E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | 5.42E-06 | 1.53E-15 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | 1.40E-12 | 4.07E-38 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319910078 | NA | 2.14E-08 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |