\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319889987:

Variant ID: vg0319889987 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19889987
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTGACTGATTACCAGCAAAGAATCCTCCATGATTTCAATAGCATCGGCTTCAACTTCCTTGAGTAATTGCAACCCTTTGAGTACTGCCTCATACTCAT[C/A]
TTGATTATTAGTTGCATTAGGTTTAATAGTATAAGCAAACTCAAAACATGCCCCCCTAGGGGAAATTATAACTAAGCCGATACCACAACCATGAGTACAC

Reverse complement sequence

GTGTACTCATGGTTGTGGTATCGGCTTAGTTATAATTTCCCCTAGGGGGGCATGTTTTGAGTTTGCTTATACTATTAAACCTAATGCAACTAATAATCAA[G/T]
ATGAGTATGAGGCAGTACTCAAAGGGTTGCAATTACTCAAGGAAGTTGAAGCCGATGCTATTGAAATCATGGAGGATTCTTTGCTGGTAATCAGTCAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 1.80% 0.87% 0.23% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 90.90% 5.70% 2.65% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 84.40% 10.00% 4.30% 1.30% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 94.60% 3.30% 1.66% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319889987 C -> A LOC_Os03g35870.1 missense_variant ; p.Asp1184Tyr; MODERATE nonsynonymous_codon ; D1184Y Average:41.342; most accessible tissue: Minghui63 flag leaf, score: 67.099 benign 0.42 DELETERIOUS 0.00
vg0319889987 C -> DEL LOC_Os03g35870.1 N frameshift_variant Average:41.342; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319889987 1.69E-06 8.62E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 9.74E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 4.86E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 1.46E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 1.13E-06 1.13E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 5.70E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 1.66E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 2.47E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 3.52E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 4.91E-07 9.09E-09 mr1897 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 6.29E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 2.07E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 3.90E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319889987 NA 1.96E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251