\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319674500:

Variant ID: vg0319674500 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19674500
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTCATGCTAGGTAAGACAAGCTAGTTCTCTTTGTTGAAACGATAAATAGTTGCTCTGTTTTATATCTCTGATATATGGGTTCTTGGTAAATACTCTCT[A/C]
AAAGGTTAAATATAAGTAGCCAACAATTATCCGGGAACCTGAGGTAAATGGGCTACACTTGCTGATCTAAGTCTAGGTTGTTGCGAGATATGAGATGGTA

Reverse complement sequence

TACCATCTCATATCTCGCAACAACCTAGACTTAGATCAGCAAGTGTAGCCCATTTACCTCAGGTTCCCGGATAATTGTTGGCTACTTATATTTAACCTTT[T/G]
AGAGAGTATTTACCAAGAACCCATATATCAGAGATATAAAACAGAGCAACTATTTATCGTTTCAACAAAGAGAACTAGCTTGTCTTACCTAGCATGACTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 31.50% 0.36% 0.44% NA
All Indica  2759 97.50% 2.10% 0.29% 0.11% NA
All Japonica  1512 12.80% 85.70% 0.26% 1.19% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.00% 0.67% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 3.70% 0.38% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 83.80% 1.66% 7.05% NA
VI/Aromatic  96 25.00% 71.90% 3.12% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319674500 A -> C LOC_Os03g35480.1 downstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0319674500 A -> C LOC_Os03g35490.1 downstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0319674500 A -> C LOC_Os03g35480-LOC_Os03g35490 intergenic_region ; MODIFIER silent_mutation Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0319674500 A -> DEL N N silent_mutation Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319674500 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.53E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 1.58E-06 8.24E-12 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 1.15E-07 5.91E-17 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 3.63E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.60E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.15E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 4.44E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 4.26E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 7.79E-07 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 2.85E-06 2.43E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.70E-17 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 5.30E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 3.77E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500 NA 1.38E-08 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251