Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319674500:

Variant ID: vg0319674500 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19674500
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTCATGCTAGGTAAGACAAGCTAGTTCTCTTTGTTGAAACGATAAATAGTTGCTCTGTTTTATATCTCTGATATATGGGTTCTTGGTAAATACTCTCT[A/C]
AAAGGTTAAATATAAGTAGCCAACAATTATCCGGGAACCTGAGGTAAATGGGCTACACTTGCTGATCTAAGTCTAGGTTGTTGCGAGATATGAGATGGTA

Reverse complement sequence

TACCATCTCATATCTCGCAACAACCTAGACTTAGATCAGCAAGTGTAGCCCATTTACCTCAGGTTCCCGGATAATTGTTGGCTACTTATATTTAACCTTT[T/G]
AGAGAGTATTTACCAAGAACCCATATATCAGAGATATAAAACAGAGCAACTATTTATCGTTTCAACAAAGAGAACTAGCTTGTCTTACCTAGCATGACTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	31.50%	0.36%	0.44%	NA
All Indica	2759	97.50%	2.10%	0.29%	0.11%	NA
All Japonica	1512	12.80%	85.70%	0.26%	1.19%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	98.30%	1.00%	0.67%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.80%	1.10%	0.11%	0.00%	NA
Indica Intermediate	786	95.50%	3.70%	0.38%	0.38%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.50%	83.80%	1.66%	7.05%	NA
VI/Aromatic	96	25.00%	71.90%	3.12%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319674500	A -> C	LOC_Os03g35480.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0319674500	A -> C	LOC_Os03g35490.1	downstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0319674500	A -> C	LOC_Os03g35480-LOC_Os03g35490	intergenic_region ; MODIFIER	silent_mutation	Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0319674500	A -> DEL	N	N	silent_mutation	Average:26.212; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319674500	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.53E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	1.58E-06	8.24E-12	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	1.15E-07	5.91E-17	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	3.63E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.60E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.15E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	4.44E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	4.26E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	7.79E-07	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	2.85E-06	2.43E-13	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.70E-17	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	5.30E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	3.77E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319674500	NA	1.38E-08	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251