Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319386807:

Variant ID: vg0319386807 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19386807
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCTTTGCTCTCAAATACAAATTATTTGCGAAAATCATATTCAATCTTATATCTCATCCCTCTATAGAGATTGTTTTACTTTATGTCTCATGTTTTGATT[T/A]
TAAAACTCGTATCTTGCTCTATAGGACCGAAACCTTTTGAAAATGTTACTTCTGTAAAAATGTAAATAAAACTACTTATAGGTCATCATAAAGCAGTAAC

Reverse complement sequence

GTTACTGCTTTATGATGACCTATAAGTAGTTTTATTTACATTTTTACAGAAGTAACATTTTCAAAAGGTTTCGGTCCTATAGAGCAAGATACGAGTTTTA[A/T]
AATCAAAACATGAGACATAAAGTAAAACAATCTCTATAGAGGGATGAGATATAAGATTGAATATGATTTTCGCAAATAATTTGTATTTGAGAGCAAAGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	0.50%	3.32%	23.11%	NA
All Indica	2759	58.90%	0.80%	5.29%	34.94%	NA
All Japonica	1512	94.40%	0.00%	0.33%	5.22%	NA
Aus	269	86.60%	0.70%	0.74%	11.90%	NA
Indica I	595	36.30%	1.70%	4.54%	57.48%	NA
Indica II	465	70.10%	0.20%	4.30%	25.38%	NA
Indica III	913	64.70%	1.10%	6.35%	27.82%	NA
Indica Intermediate	786	62.70%	0.30%	5.22%	31.81%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	87.10%	0.00%	0.79%	12.10%	NA
Japonica Intermediate	241	92.90%	0.00%	0.41%	6.64%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	78.90%	0.00%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319386807	T -> A	LOC_Os03g33970.1	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0319386807	T -> A	LOC_Os03g33980.1	upstream_gene_variant ; 3014.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0319386807	T -> A	LOC_Os03g33970-LOC_Os03g33980	intergenic_region ; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0319386807	T -> DEL	N	N	silent_mutation	Average:34.156; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319386807	1.10E-06	4.98E-10	mr1581	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319386807	6.14E-07	6.14E-07	mr1581	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251