Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319372985:

Variant ID: vg0319372985 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19372985
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGAGGCGGCAAACTCCAAGACTAACAAGCAATGACCCGGTGTGGAGATGATCAAGTGCCACACTAGCTCTACAATGGAAGCAAATGCACTTGACTCTT[G/A]
GCTAAACAACCCTCTAACACACTAGATGGATGAACACAAAGCTCAAGTGAGTGTGAGAGAGGTGCAAGGGGTGTGTGCAAATTGAATTGGGTGCCAAGAG

Reverse complement sequence

CTCTTGGCACCCAATTCAATTTGCACACACCCCTTGCACCTCTCTCACACTCACTTGAGCTTTGTGTTCATCCATCTAGTGTGTTAGAGGGTTGTTTAGC[C/T]
AAGAGTCAAGTGCATTTGCTTCCATTGTAGAGCTAGTGTGGCACTTGATCATCTCCACACCGGGTCATTGCTTGTTAGTCTTGGAGTTTGCCGCCTCCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	47.70%	0.21%	0.55%	NA
All Indica	2759	76.60%	23.00%	0.29%	0.11%	NA
All Japonica	1512	1.50%	97.10%	0.07%	1.32%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	90.40%	9.40%	0.17%	0.00%	NA
Indica II	465	72.50%	27.30%	0.22%	0.00%	NA
Indica III	913	68.50%	31.10%	0.44%	0.00%	NA
Indica Intermediate	786	78.10%	21.20%	0.25%	0.38%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	3.80%	95.80%	0.20%	0.20%	NA
Japonica Intermediate	241	0.80%	91.30%	0.00%	7.88%	NA
VI/Aromatic	96	25.00%	71.90%	0.00%	3.12%	NA
Intermediate	90	36.70%	62.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319372985	G -> A	LOC_Os03g33940.1	upstream_gene_variant ; 731.0bp to feature; MODIFIER	silent_mutation	Average:23.346; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0319372985	G -> A	LOC_Os03g33950.1	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:23.346; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0319372985	G -> A	LOC_Os03g33960.1	upstream_gene_variant ; 3842.0bp to feature; MODIFIER	silent_mutation	Average:23.346; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0319372985	G -> A	LOC_Os03g33940-LOC_Os03g33950	intergenic_region ; MODIFIER	silent_mutation	Average:23.346; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0319372985	G -> DEL	N	N	silent_mutation	Average:23.346; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319372985	5.66E-06	NA	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319372985	2.17E-06	4.22E-07	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319372985	4.45E-06	NA	mr1924	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319372985	6.49E-07	1.79E-06	mr1924	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251