Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319091202:

Variant ID: vg0319091202 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19091202
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTCCACCTATATAGCCTTTTAGAATAGGGACAAATCGGCAACCATGCCTTGGTGAGGATCCGCAAATCAAACCACGTGAGTGATTTGAGAGATTTATT[C/T]
GAAGAGTATAGCTACTTTGCGAAAATATATAAAAATCCCAAGAGATTGATAGGAGGATTAAGGAGGACTTGAGTCACGATCGTTCCATTCATCAATTGCC

Reverse complement sequence

GGCAATTGATGAATGGAACGATCGTGACTCAAGTCCTCCTTAATCCTCCTATCAATCTCTTGGGATTTTTATATATTTTCGCAAAGTAGCTATACTCTTC[G/A]
AATAAATCTCTCAAATCACTCACGTGGTTTGATTTGCGGATCCTCACCAAGGCATGGTTGCCGATTTGTCCCTATTCTAAAAGGCTATATAGGTGGAGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	32.60%	0.13%	14.26%	NA
All Indica	2759	78.60%	3.40%	0.14%	17.87%	NA
All Japonica	1512	2.10%	86.60%	0.07%	11.24%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	92.80%	2.70%	0.50%	4.03%	NA
Indica II	465	74.40%	4.10%	0.22%	21.29%	NA
Indica III	913	69.70%	1.40%	0.00%	28.92%	NA
Indica Intermediate	786	80.80%	5.70%	0.00%	13.49%	NA
Temperate Japonica	767	0.40%	99.50%	0.00%	0.13%	NA
Tropical Japonica	504	5.00%	66.30%	0.20%	28.57%	NA
Japonica Intermediate	241	1.70%	88.00%	0.00%	10.37%	NA
VI/Aromatic	96	25.00%	71.90%	0.00%	3.12%	NA
Intermediate	90	43.30%	46.70%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319091202	C -> T	LOC_Os03g33380.1	downstream_gene_variant ; 3559.0bp to feature; MODIFIER	silent_mutation	Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N
vg0319091202	C -> T	LOC_Os03g33384.1	downstream_gene_variant ; 199.0bp to feature; MODIFIER	silent_mutation	Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N
vg0319091202	C -> T	LOC_Os03g33390.1	downstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N
vg0319091202	C -> T	LOC_Os03g33380-LOC_Os03g33384	intergenic_region ; MODIFIER	silent_mutation	Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N
vg0319091202	C -> DEL	N	N	silent_mutation	Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319091202	NA	1.75E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	4.76E-06	6.52E-12	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	2.66E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	1.14E-09	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	9.31E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	1.74E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	1.83E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	5.72E-07	1.97E-16	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	1.92E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	5.21E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	2.02E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	8.79E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	2.41E-06	1.45E-13	mr1188_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	5.83E-06	5.82E-06	mr1448_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	4.17E-06	1.12E-11	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	5.01E-07	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	4.85E-11	1.38E-31	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202	NA	2.69E-09	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251