\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319091202:

Variant ID: vg0319091202 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19091202
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTCCACCTATATAGCCTTTTAGAATAGGGACAAATCGGCAACCATGCCTTGGTGAGGATCCGCAAATCAAACCACGTGAGTGATTTGAGAGATTTATT[C/T]
GAAGAGTATAGCTACTTTGCGAAAATATATAAAAATCCCAAGAGATTGATAGGAGGATTAAGGAGGACTTGAGTCACGATCGTTCCATTCATCAATTGCC

Reverse complement sequence

GGCAATTGATGAATGGAACGATCGTGACTCAAGTCCTCCTTAATCCTCCTATCAATCTCTTGGGATTTTTATATATTTTCGCAAAGTAGCTATACTCTTC[G/A]
AATAAATCTCTCAAATCACTCACGTGGTTTGATTTGCGGATCCTCACCAAGGCATGGTTGCCGATTTGTCCCTATTCTAAAAGGCTATATAGGTGGAGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 32.60% 0.13% 14.26% NA
All Indica  2759 78.60% 3.40% 0.14% 17.87% NA
All Japonica  1512 2.10% 86.60% 0.07% 11.24% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 92.80% 2.70% 0.50% 4.03% NA
Indica II  465 74.40% 4.10% 0.22% 21.29% NA
Indica III  913 69.70% 1.40% 0.00% 28.92% NA
Indica Intermediate  786 80.80% 5.70% 0.00% 13.49% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 5.00% 66.30% 0.20% 28.57% NA
Japonica Intermediate  241 1.70% 88.00% 0.00% 10.37% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 43.30% 46.70% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319091202 C -> T LOC_Os03g33380.1 downstream_gene_variant ; 3559.0bp to feature; MODIFIER silent_mutation Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0319091202 C -> T LOC_Os03g33384.1 downstream_gene_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0319091202 C -> T LOC_Os03g33390.1 downstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0319091202 C -> T LOC_Os03g33380-LOC_Os03g33384 intergenic_region ; MODIFIER silent_mutation Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0319091202 C -> DEL N N silent_mutation Average:21.192; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319091202 NA 1.75E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 4.76E-06 6.52E-12 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 2.66E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 1.14E-09 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 9.31E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 1.74E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 1.83E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 5.72E-07 1.97E-16 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 1.92E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 5.21E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 2.02E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 8.79E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 2.41E-06 1.45E-13 mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 5.83E-06 5.82E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 4.17E-06 1.12E-11 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 5.01E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 4.85E-11 1.38E-31 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091202 NA 2.69E-09 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251