\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319080319:

Variant ID: vg0319080319 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19080319
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGCCCTCTTCTCATCCTGGAGCTAGCTCAAGCTCAGCACCTCCTCCTCCTCCTGAGTATGATCCAAATGCTTTCTTCCATCCACAGTTTGCTTACTTTG[G/A]
AACGCAACCCAATGAATACTTCAACCCGGTACTTGGGGCTATTAATACCCTAAGTGAAAGCATTCAACGCTTGTCTACCGGGCAAGAAGCATTGCATGAG

Reverse complement sequence

CTCATGCAATGCTTCTTGCCCGGTAGACAAGCGTTGAATGCTTTCACTTAGGGTATTAATAGCCCCAAGTACCGGGTTGAAGTATTCATTGGGTTGCGTT[C/T]
CAAAGTAAGCAAACTGTGGATGGAAGAAAGCATTTGGATCATACTCAGGAGGAGGAGGAGGTGCTGAGCTTGAGCTAGCTCCAGGATGAGAAGAGGGCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 32.80% 0.91% 13.35% NA
All Indica  2759 78.40% 3.60% 1.09% 16.89% NA
All Japonica  1512 2.10% 86.80% 0.73% 10.38% NA
Aus  269 90.00% 9.70% 0.37% 0.00% NA
Indica I  595 92.10% 3.70% 0.17% 4.03% NA
Indica II  465 74.60% 3.40% 2.80% 19.14% NA
Indica III  913 69.60% 1.80% 0.33% 28.37% NA
Indica Intermediate  786 80.70% 5.70% 1.65% 11.96% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 66.90% 1.98% 25.99% NA
Japonica Intermediate  241 1.20% 87.60% 0.41% 10.79% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 43.30% 48.90% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319080319 G -> A LOC_Os03g33370.1 missense_variant ; p.Gly320Glu; MODERATE nonsynonymous_codon ; G320E Average:27.853; most accessible tissue: Zhenshan97 root, score: 55.432 probably damaging 2.107 DELETERIOUS 0.00
vg0319080319 G -> DEL LOC_Os03g33370.1 N frameshift_variant Average:27.853; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319080319 5.47E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 1.93E-06 5.16E-12 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 3.50E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 7.69E-08 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 7.17E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 6.46E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 9.27E-07 1.59E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 2.53E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 6.37E-10 1.23E-17 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 5.58E-06 5.58E-06 mr1834 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 2.78E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 3.82E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 5.46E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 7.31E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 9.88E-07 9.88E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 8.59E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 6.84E-10 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 3.38E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 NA 1.26E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 1.04E-06 1.04E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080319 1.28E-06 1.98E-18 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251