\
| Variant ID: vg0319023309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19023309 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 54. )
AACAATTGGCATGAATCCAATCCGTTCCAAGCAACAAGCTGTAGGAACCCTTCCCATTGATGACAAAGAACGTTGTAGGGATGGTTTTGTTGCCGACTGT[C/T]
AGCTCCACATTCAAAACTCCTTTGGTCTCTGATGGATTGCCACCAAAATCCTTAAGCACCATATTTGTCTTGATGAGATCCTGAGCGTTTCTGCCCAACT
AGTTGGGCAGAAACGCTCAGGATCTCATCAAGACAAATATGGTGCTTAAGGATTTTGGTGGCAATCCATCAGAGACCAAAGGAGTTTTGAATGTGGAGCT[G/A]
ACAGTCGGCAACAAAACCATCCCTACAACGTTCTTTGTCATCAATGGGAAGGGTTCCTACAGCTTGTTGCTTGGAACGGATTGGATTCATGCCAATTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 39.90% | 3.26% | 3.75% | NA |
| All Indica | 2759 | 24.20% | 65.00% | 5.18% | 5.55% | NA |
| All Japonica | 1512 | 97.30% | 0.70% | 0.66% | 1.39% | NA |
| Aus | 269 | 82.20% | 17.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 44.50% | 52.90% | 1.51% | 1.01% | NA |
| Indica II | 465 | 15.30% | 69.20% | 7.53% | 7.96% | NA |
| Indica III | 913 | 17.10% | 67.40% | 6.57% | 8.98% | NA |
| Indica Intermediate | 786 | 22.50% | 69.00% | 4.96% | 3.56% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 1.40% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.40% | 3.73% | 3.73% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 36.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319023309 | C -> T | LOC_Os03g33240.1 | downstream_gene_variant ; 3166.0bp to feature; MODIFIER | silent_mutation | Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0319023309 | C -> T | LOC_Os03g33260.1 | downstream_gene_variant ; 4176.0bp to feature; MODIFIER | silent_mutation | Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0319023309 | C -> T | LOC_Os03g33250.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0319023309 | C -> DEL | N | N | silent_mutation | Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319023309 | NA | 4.47E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | 3.97E-06 | 3.97E-06 | mr1102 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | NA | 6.08E-07 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | NA | 5.86E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | NA | 6.50E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | 8.53E-06 | 8.53E-06 | mr1776 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | 8.64E-06 | 8.64E-06 | mr1779 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | 7.92E-06 | 1.86E-10 | mr1785 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | NA | 1.20E-06 | mr1785 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319023309 | NA | 9.56E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |