Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319023309:

Variant ID: vg0319023309 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19023309
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

AACAATTGGCATGAATCCAATCCGTTCCAAGCAACAAGCTGTAGGAACCCTTCCCATTGATGACAAAGAACGTTGTAGGGATGGTTTTGTTGCCGACTGT[C/T]
AGCTCCACATTCAAAACTCCTTTGGTCTCTGATGGATTGCCACCAAAATCCTTAAGCACCATATTTGTCTTGATGAGATCCTGAGCGTTTCTGCCCAACT

Reverse complement sequence

AGTTGGGCAGAAACGCTCAGGATCTCATCAAGACAAATATGGTGCTTAAGGATTTTGGTGGCAATCCATCAGAGACCAAAGGAGTTTTGAATGTGGAGCT[G/A]
ACAGTCGGCAACAAAACCATCCCTACAACGTTCTTTGTCATCAATGGGAAGGGTTCCTACAGCTTGTTGCTTGGAACGGATTGGATTCATGCCAATTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	39.90%	3.26%	3.75%	NA
All Indica	2759	24.20%	65.00%	5.18%	5.55%	NA
All Japonica	1512	97.30%	0.70%	0.66%	1.39%	NA
Aus	269	82.20%	17.50%	0.00%	0.37%	NA
Indica I	595	44.50%	52.90%	1.51%	1.01%	NA
Indica II	465	15.30%	69.20%	7.53%	7.96%	NA
Indica III	913	17.10%	67.40%	6.57%	8.98%	NA
Indica Intermediate	786	22.50%	69.00%	4.96%	3.56%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	1.40%	0.20%	2.38%	NA
Japonica Intermediate	241	92.10%	0.40%	3.73%	3.73%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	61.10%	36.70%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319023309	C -> T	LOC_Os03g33240.1	downstream_gene_variant ; 3166.0bp to feature; MODIFIER	silent_mutation	Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N
vg0319023309	C -> T	LOC_Os03g33260.1	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N
vg0319023309	C -> T	LOC_Os03g33250.1	intron_variant ; MODIFIER	silent_mutation	Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N
vg0319023309	C -> DEL	N	N	silent_mutation	Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319023309	NA	4.47E-06	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	3.97E-06	3.97E-06	mr1102	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	NA	6.08E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	NA	5.86E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	NA	6.50E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	8.53E-06	8.53E-06	mr1776	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	8.64E-06	8.64E-06	mr1779	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	7.92E-06	1.86E-10	mr1785	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	NA	1.20E-06	mr1785	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309	NA	9.56E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251