\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319023309:

Variant ID: vg0319023309 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19023309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATTGGCATGAATCCAATCCGTTCCAAGCAACAAGCTGTAGGAACCCTTCCCATTGATGACAAAGAACGTTGTAGGGATGGTTTTGTTGCCGACTGT[C/T]
AGCTCCACATTCAAAACTCCTTTGGTCTCTGATGGATTGCCACCAAAATCCTTAAGCACCATATTTGTCTTGATGAGATCCTGAGCGTTTCTGCCCAACT

Reverse complement sequence

AGTTGGGCAGAAACGCTCAGGATCTCATCAAGACAAATATGGTGCTTAAGGATTTTGGTGGCAATCCATCAGAGACCAAAGGAGTTTTGAATGTGGAGCT[G/A]
ACAGTCGGCAACAAAACCATCCCTACAACGTTCTTTGTCATCAATGGGAAGGGTTCCTACAGCTTGTTGCTTGGAACGGATTGGATTCATGCCAATTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 39.90% 3.26% 3.75% NA
All Indica  2759 24.20% 65.00% 5.18% 5.55% NA
All Japonica  1512 97.30% 0.70% 0.66% 1.39% NA
Aus  269 82.20% 17.50% 0.00% 0.37% NA
Indica I  595 44.50% 52.90% 1.51% 1.01% NA
Indica II  465 15.30% 69.20% 7.53% 7.96% NA
Indica III  913 17.10% 67.40% 6.57% 8.98% NA
Indica Intermediate  786 22.50% 69.00% 4.96% 3.56% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 1.40% 0.20% 2.38% NA
Japonica Intermediate  241 92.10% 0.40% 3.73% 3.73% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 61.10% 36.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319023309 C -> T LOC_Os03g33240.1 downstream_gene_variant ; 3166.0bp to feature; MODIFIER silent_mutation Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N
vg0319023309 C -> T LOC_Os03g33260.1 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N
vg0319023309 C -> T LOC_Os03g33250.1 intron_variant ; MODIFIER silent_mutation Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N
vg0319023309 C -> DEL N N silent_mutation Average:13.333; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319023309 NA 4.47E-06 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 3.97E-06 3.97E-06 mr1102 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 NA 6.08E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 NA 5.86E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 NA 6.50E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 8.53E-06 8.53E-06 mr1776 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 8.64E-06 8.64E-06 mr1779 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 7.92E-06 1.86E-10 mr1785 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 NA 1.20E-06 mr1785 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319023309 NA 9.56E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251