\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318960151:

Variant ID: vg0318960151 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18960151
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCACCGGACTTCCAAAAACCCAAGGCGGATATGATTCTATATGGGTAGTTGTGGACCGACTAACCAAGGTAGCTCGGTTTATTCCTGTGAAGACCACCT[G/A]
TGGAGGGAACAAACTAGCCGATCTCTACTTCGCTAGGATCGTGAGTCTCCATGGCATTCCTAAGAAAATTGTATCTGATAGGGGAAGCCAATTCACCTCT

Reverse complement sequence

AGAGGTGAATTGGCTTCCCCTATCAGATACAATTTTCTTAGGAATGCCATGGAGACTCACGATCCTAGCGAAGTAGAGATCGGCTAGTTTGTTCCCTCCA[C/T]
AGGTGGTCTTCACAGGAATAAACCGAGCTACCTTGGTTAGTCGGTCCACAACTACCCATATAGAATCATATCCGCCTTGGGTTTTTGGAAGTCCGGTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 0.10% 29.64% 36.10% NA
All Indica  2759 5.50% 0.10% 42.48% 51.90% NA
All Japonica  1512 86.40% 0.10% 0.53% 12.90% NA
Aus  269 11.90% 0.00% 69.52% 18.59% NA
Indica I  595 4.70% 0.50% 27.73% 67.06% NA
Indica II  465 5.20% 0.00% 39.14% 55.70% NA
Indica III  913 3.80% 0.00% 56.74% 39.43% NA
Indica Intermediate  786 8.30% 0.00% 39.06% 52.67% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 66.50% 0.40% 1.39% 31.75% NA
Japonica Intermediate  241 85.90% 0.00% 0.41% 13.69% NA
VI/Aromatic  96 76.00% 0.00% 20.83% 3.12% NA
Intermediate  90 54.40% 1.10% 15.56% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318960151 G -> A LOC_Os03g33140.1 missense_variant ; p.Cys863Tyr; MODERATE nonsynonymous_codon ; C863Y Average:6.66; most accessible tissue: Callus, score: 13.272 probably damaging -3.458 TOLERATED 1.00
vg0318960151 G -> DEL LOC_Os03g33140.1 N frameshift_variant Average:6.66; most accessible tissue: Callus, score: 13.272 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318960151 NA 2.64E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 8.71E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 1.37E-06 9.79E-16 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.32E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 2.84E-14 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 5.52E-14 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.45E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.58E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 5.02E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 8.11E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.84E-13 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 3.23E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.52E-11 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 4.97E-08 8.79E-19 mr1022_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 4.31E-13 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 3.28E-16 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 8.46E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 3.02E-15 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 7.73E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.05E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 2.43E-14 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 3.79E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 6.63E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 4.41E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 9.82E-07 6.18E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 3.70E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 1.52E-08 4.37E-19 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151 NA 1.07E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251