Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318960151:

Variant ID: vg0318960151 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18960151
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCACCGGACTTCCAAAAACCCAAGGCGGATATGATTCTATATGGGTAGTTGTGGACCGACTAACCAAGGTAGCTCGGTTTATTCCTGTGAAGACCACCT[G/A]
TGGAGGGAACAAACTAGCCGATCTCTACTTCGCTAGGATCGTGAGTCTCCATGGCATTCCTAAGAAAATTGTATCTGATAGGGGAAGCCAATTCACCTCT

Reverse complement sequence

AGAGGTGAATTGGCTTCCCCTATCAGATACAATTTTCTTAGGAATGCCATGGAGACTCACGATCCTAGCGAAGTAGAGATCGGCTAGTTTGTTCCCTCCA[C/T]
AGGTGGTCTTCACAGGAATAAACCGAGCTACCTTGGTTAGTCGGTCCACAACTACCCATATAGAATCATATCCGCCTTGGGTTTTTGGAAGTCCGGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	0.10%	29.64%	36.10%	NA
All Indica	2759	5.50%	0.10%	42.48%	51.90%	NA
All Japonica	1512	86.40%	0.10%	0.53%	12.90%	NA
Aus	269	11.90%	0.00%	69.52%	18.59%	NA
Indica I	595	4.70%	0.50%	27.73%	67.06%	NA
Indica II	465	5.20%	0.00%	39.14%	55.70%	NA
Indica III	913	3.80%	0.00%	56.74%	39.43%	NA
Indica Intermediate	786	8.30%	0.00%	39.06%	52.67%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	66.50%	0.40%	1.39%	31.75%	NA
Japonica Intermediate	241	85.90%	0.00%	0.41%	13.69%	NA
VI/Aromatic	96	76.00%	0.00%	20.83%	3.12%	NA
Intermediate	90	54.40%	1.10%	15.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318960151	G -> A	LOC_Os03g33140.1	missense_variant ; p.Cys863Tyr; MODERATE	nonsynonymous_codon ; C863Y	Average:6.66; most accessible tissue: Callus, score: 13.272	probably damaging	-3.458	TOLERATED	1.00
vg0318960151	G -> DEL	LOC_Os03g33140.1	N	frameshift_variant	Average:6.66; most accessible tissue: Callus, score: 13.272	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318960151	NA	2.64E-14	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	8.71E-13	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	1.37E-06	9.79E-16	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.32E-12	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	2.84E-14	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	5.52E-14	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.45E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.58E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	5.02E-12	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	8.11E-12	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.84E-13	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	3.23E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.52E-11	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	4.97E-08	8.79E-19	mr1022_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	4.31E-13	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	3.28E-16	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	8.46E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	3.02E-15	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	7.73E-14	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.05E-13	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	2.43E-14	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	3.79E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	6.63E-12	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	4.41E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	9.82E-07	6.18E-14	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	3.70E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	1.52E-08	4.37E-19	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318960151	NA	1.07E-07	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251