\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318925726:

Variant ID: vg0318925726 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18925726
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCGAGGGAGGAGGAGGCGACAGCGTTGAGGACGAGGAGGCGGCGGCTGTCGGTGAAACGGCCGCGGCGTCGGTCTTGAGGACTAGGCGGAGAGGAAGC[T/C,A]
GGCGATGGCGGTCTTGGGCGTGGAGGACACGGACTTGGAGAGGAGGCCGGCGGCGGCGGCGGTCTTGGGCGCGGAGGAGGCGCTGGAGGCGGTGGATCTA

Reverse complement sequence

TAGATCCACCGCCTCCAGCGCCTCCTCCGCGCCCAAGACCGCCGCCGCCGCCGGCCTCCTCTCCAAGTCCGTGTCCTCCACGCCCAAGACCGCCATCGCC[A/G,T]
GCTTCCTCTCCGCCTAGTCCTCAAGACCGACGCCGCGGCCGTTTCACCGACAGCCGCCGCCTCCTCGTCCTCAACGCTGTCGCCTCCTCCTCCCTCGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 31.90% 1.44% 0.59% A: 0.11%
All Indica  2759 95.20% 2.50% 2.03% 0.11% A: 0.18%
All Japonica  1512 12.10% 85.80% 0.66% 1.46% NA
Aus  269 89.60% 10.00% 0.37% 0.00% NA
Indica I  595 93.60% 2.00% 4.37% 0.00% NA
Indica II  465 94.80% 3.20% 1.94% 0.00% NA
Indica III  913 98.40% 1.10% 0.22% 0.00% A: 0.33%
Indica Intermediate  786 93.00% 3.90% 2.42% 0.38% A: 0.25%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 32.10% 65.70% 1.98% 0.20% NA
Japonica Intermediate  241 7.50% 83.80% 0.00% 8.71% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318925726 T -> C LOC_Os03g33060.1 upstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> C LOC_Os03g33070.1 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> C LOC_Os03g33074.1 upstream_gene_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> C LOC_Os03g33080.1 downstream_gene_variant ; 791.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> C LOC_Os03g33070-LOC_Os03g33074 intergenic_region ; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> A LOC_Os03g33060.1 upstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> A LOC_Os03g33070.1 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> A LOC_Os03g33074.1 upstream_gene_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> A LOC_Os03g33080.1 downstream_gene_variant ; 791.0bp to feature; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> A LOC_Os03g33070-LOC_Os03g33074 intergenic_region ; MODIFIER silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N
vg0318925726 T -> DEL N N silent_mutation Average:76.13; most accessible tissue: Zhenshan97 flag leaf, score: 89.139 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0318925726 T A -0.01 -0.01 0.0 0.0 0.0 0.0
vg0318925726 T C 0.01 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318925726 NA 6.38E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 3.64E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 7.02E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 2.29E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 7.09E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 4.87E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 3.94E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 9.82E-19 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 1.54E-08 mr1304 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 9.32E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 3.40E-07 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 1.31E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 1.87E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 2.77E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 2.37E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 1.03E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 4.17E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 3.97E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 8.68E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318925726 NA 3.74E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251