\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318765858:

Variant ID: vg0318765858 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18765858
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCTTTCCCCCCCTTCAGTAAGAGAAGCTTTGGAGAAGAAGTCTTAGGTGGAGTCCTGGCTTATACCCCAGTTGAGCGCCTGTGAAGATGGAGCCATAG[T/G]
CCCGCTAGTCCGCTGCTGTTTATTTTTGATTGTCAGGCCTTAAGTGCCTTTGTAATAATGTAAATATTATCGATATAATAAAGATGTGTCTTTTGTATCA

Reverse complement sequence

TGATACAAAAGACACATCTTTATTATATCGATAATATTTACATTATTACAAAGGCACTTAAGGCCTGACAATCAAAAATAAACAGCAGCGGACTAGCGGG[A/C]
CTATGGCTCCATCTTCACAGGCGCTCAACTGGGGTATAAGCCAGGACTCCACCTAAGACTTCTTCTCCAAAGCTTCTCTTACTGAAGGGGGGGAAAGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 31.70% 0.93% 0.08% NA
All Indica  2759 97.00% 2.20% 0.69% 0.14% NA
All Japonica  1512 12.70% 86.00% 1.32% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 97.10% 1.30% 1.51% 0.00% NA
Indica II  465 96.30% 2.80% 0.43% 0.43% NA
Indica III  913 98.70% 1.10% 0.11% 0.11% NA
Indica Intermediate  786 95.30% 3.70% 0.89% 0.13% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 65.90% 0.20% 0.00% NA
Japonica Intermediate  241 7.50% 84.60% 7.88% 0.00% NA
VI/Aromatic  96 25.00% 71.90% 3.12% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318765858 T -> DEL N N silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0318765858 T -> G LOC_Os03g32780.1 upstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0318765858 T -> G LOC_Os03g32790.1 upstream_gene_variant ; 2752.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0318765858 T -> G LOC_Os03g32790.2 upstream_gene_variant ; 2752.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0318765858 T -> G LOC_Os03g32790.3 upstream_gene_variant ; 2752.0bp to feature; MODIFIER silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0318765858 T -> G LOC_Os03g32780-LOC_Os03g32790 intergenic_region ; MODIFIER silent_mutation Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318765858 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 1.09E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 7.55E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 4.88E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 1.57E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 1.25E-07 4.65E-17 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 1.91E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 1.26E-08 7.07E-15 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 8.33E-06 5.63E-25 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858 NA 9.80E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251