Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318765858:

Variant ID: vg0318765858 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18765858
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCTTTCCCCCCCTTCAGTAAGAGAAGCTTTGGAGAAGAAGTCTTAGGTGGAGTCCTGGCTTATACCCCAGTTGAGCGCCTGTGAAGATGGAGCCATAG[T/G]
CCCGCTAGTCCGCTGCTGTTTATTTTTGATTGTCAGGCCTTAAGTGCCTTTGTAATAATGTAAATATTATCGATATAATAAAGATGTGTCTTTTGTATCA

Reverse complement sequence

TGATACAAAAGACACATCTTTATTATATCGATAATATTTACATTATTACAAAGGCACTTAAGGCCTGACAATCAAAAATAAACAGCAGCGGACTAGCGGG[A/C]
CTATGGCTCCATCTTCACAGGCGCTCAACTGGGGTATAAGCCAGGACTCCACCTAAGACTTCTTCTCCAAAGCTTCTCTTACTGAAGGGGGGGAAAGATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	31.70%	0.93%	0.08%	NA
All Indica	2759	97.00%	2.20%	0.69%	0.14%	NA
All Japonica	1512	12.70%	86.00%	1.32%	0.00%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	97.10%	1.30%	1.51%	0.00%	NA
Indica II	465	96.30%	2.80%	0.43%	0.43%	NA
Indica III	913	98.70%	1.10%	0.11%	0.11%	NA
Indica Intermediate	786	95.30%	3.70%	0.89%	0.13%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	33.90%	65.90%	0.20%	0.00%	NA
Japonica Intermediate	241	7.50%	84.60%	7.88%	0.00%	NA
VI/Aromatic	96	25.00%	71.90%	3.12%	0.00%	NA
Intermediate	90	50.00%	47.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318765858	T -> DEL	N	N	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0318765858	T -> G	LOC_Os03g32780.1	upstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0318765858	T -> G	LOC_Os03g32790.1	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0318765858	T -> G	LOC_Os03g32790.2	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0318765858	T -> G	LOC_Os03g32790.3	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0318765858	T -> G	LOC_Os03g32780-LOC_Os03g32790	intergenic_region ; MODIFIER	silent_mutation	Average:18.663; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318765858	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	1.09E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	7.55E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	4.88E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	1.57E-09	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	1.25E-07	4.65E-17	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	1.91E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	1.26E-08	7.07E-15	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	8.33E-06	5.63E-25	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318765858	NA	9.80E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251