Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318763839:

Variant ID: vg0318763839 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18763839
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TCCAAGGATCGCCACCGGAGTCGTCCCCTCGCCTTTCGTCTCCATCGTTCCCGGCCGTCTCCGCCGCGCCCGTTCGTCGTTGTCGTTCCCTCGCCTCGTC[A/G]
CGTGGTGGTAAGGATCTCTCTCCCTCGTCGCCCTCGTCCTCGTCCTTTTGGTGTCGCCCGTGCCCGTTGTGCGGTTGTCGACCCCGGTACCCGTGTACTG

Reverse complement sequence

CAGTACACGGGTACCGGGGTCGACAACCGCACAACGGGCACGGGCGACACCAAAAGGACGAGGACGAGGGCGACGAGGGAGAGAGATCCTTACCACCACG[T/C]
GACGAGGCGAGGGAACGACAACGACGAACGGGCGCGGCGGAGACGGCCGGGAACGATGGAGACGAAAGGCGAGGGGACGACTCCGGTGGCGATCCTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.80%	35.30%	11.85%	0.02%	NA
All Indica	2759	75.30%	7.70%	16.93%	0.04%	NA
All Japonica	1512	12.20%	86.20%	1.59%	0.00%	NA
Aus	269	66.20%	13.00%	20.82%	0.00%	NA
Indica I	595	60.80%	5.50%	33.61%	0.00%	NA
Indica II	465	77.00%	6.90%	15.91%	0.22%	NA
Indica III	913	85.80%	7.80%	6.46%	0.00%	NA
Indica Intermediate	786	73.20%	9.80%	17.05%	0.00%	NA
Temperate Japonica	767	0.30%	99.60%	0.13%	0.00%	NA
Tropical Japonica	504	32.90%	66.10%	0.99%	0.00%	NA
Japonica Intermediate	241	7.10%	85.50%	7.47%	0.00%	NA
VI/Aromatic	96	24.00%	71.90%	4.17%	0.00%	NA
Intermediate	90	36.70%	53.30%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318763839	A -> DEL	N	N	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32780.1	upstream_gene_variant ; 441.0bp to feature; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32790.1	upstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32790.2	upstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32790.3	upstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32770.1	downstream_gene_variant ; 3397.0bp to feature; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N
vg0318763839	A -> G	LOC_Os03g32780-LOC_Os03g32790	intergenic_region ; MODIFIER	silent_mutation	Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318763839	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	2.04E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	3.36E-22	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	1.71E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	7.37E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	1.12E-07	4.45E-10	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	4.69E-08	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	3.43E-11	2.48E-21	mr1750	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	4.32E-21	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	5.50E-16	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	6.89E-07	6.89E-07	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	1.06E-07	3.36E-24	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839	NA	1.10E-08	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251