\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318763839:

Variant ID: vg0318763839 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18763839
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAGGATCGCCACCGGAGTCGTCCCCTCGCCTTTCGTCTCCATCGTTCCCGGCCGTCTCCGCCGCGCCCGTTCGTCGTTGTCGTTCCCTCGCCTCGTC[A/G]
CGTGGTGGTAAGGATCTCTCTCCCTCGTCGCCCTCGTCCTCGTCCTTTTGGTGTCGCCCGTGCCCGTTGTGCGGTTGTCGACCCCGGTACCCGTGTACTG

Reverse complement sequence

CAGTACACGGGTACCGGGGTCGACAACCGCACAACGGGCACGGGCGACACCAAAAGGACGAGGACGAGGGCGACGAGGGAGAGAGATCCTTACCACCACG[T/C]
GACGAGGCGAGGGAACGACAACGACGAACGGGCGCGGCGGAGACGGCCGGGAACGATGGAGACGAAAGGCGAGGGGACGACTCCGGTGGCGATCCTTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 35.30% 11.85% 0.02% NA
All Indica  2759 75.30% 7.70% 16.93% 0.04% NA
All Japonica  1512 12.20% 86.20% 1.59% 0.00% NA
Aus  269 66.20% 13.00% 20.82% 0.00% NA
Indica I  595 60.80% 5.50% 33.61% 0.00% NA
Indica II  465 77.00% 6.90% 15.91% 0.22% NA
Indica III  913 85.80% 7.80% 6.46% 0.00% NA
Indica Intermediate  786 73.20% 9.80% 17.05% 0.00% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 32.90% 66.10% 0.99% 0.00% NA
Japonica Intermediate  241 7.10% 85.50% 7.47% 0.00% NA
VI/Aromatic  96 24.00% 71.90% 4.17% 0.00% NA
Intermediate  90 36.70% 53.30% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318763839 A -> DEL N N silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32780.1 upstream_gene_variant ; 441.0bp to feature; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32790.1 upstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32790.2 upstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32790.3 upstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32770.1 downstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N
vg0318763839 A -> G LOC_Os03g32780-LOC_Os03g32790 intergenic_region ; MODIFIER silent_mutation Average:20.659; most accessible tissue: Zhenshan97 young leaf, score: 29.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318763839 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 2.04E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 3.36E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 1.71E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 7.37E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 1.12E-07 4.45E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 4.69E-08 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 3.43E-11 2.48E-21 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 4.32E-21 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 5.50E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 6.89E-07 6.89E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 1.06E-07 3.36E-24 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318763839 NA 1.10E-08 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251