\
| Variant ID: vg0318543836 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18543836 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAATATAATGTATACATCTAATAAAATTAAAAATCTTGAGAATGGAGGATTTAAAAATAATAATTAAGTGAATAGAATGTGCTAGTTAATTACATGTATA[C/T]
ATGCACGCCTTATATTATGAAATACATTAAAAAAATAGTTACTTTATATTCCTTCCGTTTGATTAAAAAATCGTTTGACTTTTTCTTAGTCAGAGTTTTT
AAAAACTCTGACTAAGAAAAAGTCAAACGATTTTTTAATCAAACGGAAGGAATATAAAGTAACTATTTTTTTAATGTATTTCATAATATAAGGCGTGCAT[G/A]
TATACATGTAATTAACTAGCACATTCTATTCACTTAATTATTATTTTTAAATCCTCCATTCTCAAGATTTTTAATTTTATTAGATGTATACATTATATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 31.30% | 0.28% | 0.06% | NA |
| All Indica | 2759 | 97.70% | 2.00% | 0.18% | 0.07% | NA |
| All Japonica | 1512 | 14.60% | 85.10% | 0.26% | 0.00% | NA |
| Aus | 269 | 90.00% | 9.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.70% | 0.50% | 0.17% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.80% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 39.70% | 59.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 91.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 42.20% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318543836 | C -> T | LOC_Os03g32430.1 | upstream_gene_variant ; 397.0bp to feature; MODIFIER | silent_mutation | Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0318543836 | C -> T | LOC_Os03g32420.1 | downstream_gene_variant ; 3741.0bp to feature; MODIFIER | silent_mutation | Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0318543836 | C -> T | LOC_Os03g32420-LOC_Os03g32430 | intergenic_region ; MODIFIER | silent_mutation | Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0318543836 | C -> DEL | N | N | silent_mutation | Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318543836 | NA | 4.39E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 3.15E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 1.27E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 1.06E-07 | 3.61E-12 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 3.37E-09 | 6.23E-22 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 3.37E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 4.37E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 3.05E-06 | 3.05E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 9.55E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 6.31E-07 | 2.99E-15 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 4.03E-06 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | 1.07E-14 | 4.47E-41 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 1.29E-13 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318543836 | NA | 9.45E-10 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |