\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318543836:

Variant ID: vg0318543836 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18543836
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATATAATGTATACATCTAATAAAATTAAAAATCTTGAGAATGGAGGATTTAAAAATAATAATTAAGTGAATAGAATGTGCTAGTTAATTACATGTATA[C/T]
ATGCACGCCTTATATTATGAAATACATTAAAAAAATAGTTACTTTATATTCCTTCCGTTTGATTAAAAAATCGTTTGACTTTTTCTTAGTCAGAGTTTTT

Reverse complement sequence

AAAAACTCTGACTAAGAAAAAGTCAAACGATTTTTTAATCAAACGGAAGGAATATAAAGTAACTATTTTTTTAATGTATTTCATAATATAAGGCGTGCAT[G/A]
TATACATGTAATTAACTAGCACATTCTATTCACTTAATTATTATTTTTAAATCCTCCATTCTCAAGATTTTTAATTTTATTAGATGTATACATTATATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 31.30% 0.28% 0.06% NA
All Indica  2759 97.70% 2.00% 0.18% 0.07% NA
All Japonica  1512 14.60% 85.10% 0.26% 0.00% NA
Aus  269 90.00% 9.70% 0.37% 0.00% NA
Indica I  595 98.70% 0.70% 0.50% 0.17% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.80% 0.25% 0.13% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 39.70% 59.90% 0.40% 0.00% NA
Japonica Intermediate  241 7.90% 91.70% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318543836 C -> T LOC_Os03g32430.1 upstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0318543836 C -> T LOC_Os03g32420.1 downstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0318543836 C -> T LOC_Os03g32420-LOC_Os03g32430 intergenic_region ; MODIFIER silent_mutation Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0318543836 C -> DEL N N silent_mutation Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318543836 NA 4.39E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 3.15E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 1.27E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 1.06E-07 3.61E-12 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 3.37E-09 6.23E-22 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 3.37E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 4.37E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 3.05E-06 3.05E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 9.55E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 6.31E-07 2.99E-15 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 4.03E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 1.07E-14 4.47E-41 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 1.29E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836 NA 9.45E-10 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251