Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318543836:

Variant ID: vg0318543836 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18543836
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATATAATGTATACATCTAATAAAATTAAAAATCTTGAGAATGGAGGATTTAAAAATAATAATTAAGTGAATAGAATGTGCTAGTTAATTACATGTATA[C/T]
ATGCACGCCTTATATTATGAAATACATTAAAAAAATAGTTACTTTATATTCCTTCCGTTTGATTAAAAAATCGTTTGACTTTTTCTTAGTCAGAGTTTTT

Reverse complement sequence

AAAAACTCTGACTAAGAAAAAGTCAAACGATTTTTTAATCAAACGGAAGGAATATAAAGTAACTATTTTTTTAATGTATTTCATAATATAAGGCGTGCAT[G/A]
TATACATGTAATTAACTAGCACATTCTATTCACTTAATTATTATTTTTAAATCCTCCATTCTCAAGATTTTTAATTTTATTAGATGTATACATTATATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.40%	31.30%	0.28%	0.06%	NA
All Indica	2759	97.70%	2.00%	0.18%	0.07%	NA
All Japonica	1512	14.60%	85.10%	0.26%	0.00%	NA
Aus	269	90.00%	9.70%	0.37%	0.00%	NA
Indica I	595	98.70%	0.70%	0.50%	0.17%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.80%	0.25%	0.13%	NA
Temperate Japonica	767	0.30%	99.60%	0.13%	0.00%	NA
Tropical Japonica	504	39.70%	59.90%	0.40%	0.00%	NA
Japonica Intermediate	241	7.90%	91.70%	0.41%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	42.20%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318543836	C -> T	LOC_Os03g32430.1	upstream_gene_variant ; 397.0bp to feature; MODIFIER	silent_mutation	Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0318543836	C -> T	LOC_Os03g32420.1	downstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0318543836	C -> T	LOC_Os03g32420-LOC_Os03g32430	intergenic_region ; MODIFIER	silent_mutation	Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0318543836	C -> DEL	N	N	silent_mutation	Average:38.347; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318543836	NA	4.39E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	3.15E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	1.27E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	1.06E-07	3.61E-12	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	3.37E-09	6.23E-22	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	3.37E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	4.37E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	3.05E-06	3.05E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	9.55E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	6.31E-07	2.99E-15	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	4.03E-06	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	1.07E-14	4.47E-41	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	1.29E-13	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318543836	NA	9.45E-10	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251