Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318243009:

Variant ID: vg0318243009 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18243009
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTGGCGATTTATTGAGACTCGTCAAGAACATTCTTCCGGAGGGAAACAAATTGCCCGAGACAACGTACGAGGCTAAGAAGATAGTCTGCCCTCTAGG[G/A]
CTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCTATATCGCGGTGAGGAGTACGAGAACCTAGAAGCATGCCCTGTTTGTAAAGCACTAC

Reverse complement sequence

GTAGTGCTTTACAAACAGGGCATGCTTCTAGGTTCTCGTACTCCTCACCGCGATATAGGATACAATCATTCGGACATGCGTGAATCTTCTGAACTTCCAG[C/T]
CCTAGAGGGCAGACTATCTTCTTAGCCTCGTACGTTGTCTCGGGCAATTTGTTTCCCTCCGGAAGAATGTTCTTGACGAGTCTCAATAAATCGCCAAATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.30%	31.40%	0.25%	0.00%	NA
All Indica	2759	96.60%	3.00%	0.40%	0.00%	NA
All Japonica	1512	16.00%	84.00%	0.00%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	96.10%	3.40%	0.43%	0.00%	NA
Indica III	913	96.90%	2.40%	0.66%	0.00%	NA
Indica Intermediate	786	95.50%	4.10%	0.38%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	39.70%	60.30%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.40%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318243009	G -> A	LOC_Os03g31890.1	synonymous_variant ; p.Gly122Gly; LOW	synonymous_codon	Average:23.107; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0318243009	G -> A	LOC_Os03g31890.1	synonymous_variant ; p.Gly122Gly; LOW	nonsynonymous_codon ; G122V	Average:23.107; most accessible tissue: Minghui63 panicle, score: 42.799	probably damaging	2.728	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318243009	NA	5.90E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.62E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	2.12E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.05E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.78E-06	mr1607	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.28E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.19E-09	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.54E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	9.37E-06	mr1890	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	5.78E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	2.90E-15	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	1.18E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009	NA	9.30E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251