\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318243009:

Variant ID: vg0318243009 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18243009
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTGGCGATTTATTGAGACTCGTCAAGAACATTCTTCCGGAGGGAAACAAATTGCCCGAGACAACGTACGAGGCTAAGAAGATAGTCTGCCCTCTAGG[G/A]
CTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCTATATCGCGGTGAGGAGTACGAGAACCTAGAAGCATGCCCTGTTTGTAAAGCACTAC

Reverse complement sequence

GTAGTGCTTTACAAACAGGGCATGCTTCTAGGTTCTCGTACTCCTCACCGCGATATAGGATACAATCATTCGGACATGCGTGAATCTTCTGAACTTCCAG[C/T]
CCTAGAGGGCAGACTATCTTCTTAGCCTCGTACGTTGTCTCGGGCAATTTGTTTCCCTCCGGAAGAATGTTCTTGACGAGTCTCAATAAATCGCCAAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 31.40% 0.25% 0.00% NA
All Indica  2759 96.60% 3.00% 0.40% 0.00% NA
All Japonica  1512 16.00% 84.00% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 96.10% 3.40% 0.43% 0.00% NA
Indica III  913 96.90% 2.40% 0.66% 0.00% NA
Indica Intermediate  786 95.50% 4.10% 0.38% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 39.70% 60.30% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318243009 G -> A LOC_Os03g31890.1 synonymous_variant ; p.Gly122Gly; LOW synonymous_codon Average:23.107; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0318243009 G -> A LOC_Os03g31890.1 synonymous_variant ; p.Gly122Gly; LOW nonsynonymous_codon ; G122V Average:23.107; most accessible tissue: Minghui63 panicle, score: 42.799 probably damaging 2.728 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318243009 NA 5.90E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.62E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 2.12E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.05E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.78E-06 mr1607 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.28E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.19E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.54E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 9.37E-06 mr1890 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 5.78E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 2.90E-15 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 1.18E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318243009 NA 9.30E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251