\
| Variant ID: vg0318146978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18146978 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 232. )
ATTAGTCTACTCCCCTGTCTCAGAATCCACATTAGTCTACTACTCCATCTGTCTCAGAATAAGTTAATCTAATACGACACGAGATGTGGCATATTTTAGA[G/A]
TCTGCTTAGGGAGCCTCTATCAACTACAGTCTACTTAGCCCCCAAACAATCTAGATTATCACCTAGAACCCAAAAAATGAACTAGGCCATGTTGGGGAAG
CTTCCCCAACATGGCCTAGTTCATTTTTTGGGTTCTAGGTGATAATCTAGATTGTTTGGGGGCTAAGTAGACTGTAGTTGATAGAGGCTCCCTAAGCAGA[C/T]
TCTAAAATATGCCACATCTCGTGTCGTATTAGATTAACTTATTCTGAGACAGATGGAGTAGTAGACTAATGTGGATTCTGAGACAGGGGAGTAGACTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 28.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 67.80% | 32.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.60% | 45.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 72.90% | 26.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 69.10% | 30.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 73.20% | 26.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318146978 | G -> A | LOC_Os03g31740.1 | upstream_gene_variant ; 1078.0bp to feature; MODIFIER | silent_mutation | Average:68.602; most accessible tissue: Minghui63 young leaf, score: 79.896 | N | N | N | N |
| vg0318146978 | G -> A | LOC_Os03g31730.1 | downstream_gene_variant ; 3681.0bp to feature; MODIFIER | silent_mutation | Average:68.602; most accessible tissue: Minghui63 young leaf, score: 79.896 | N | N | N | N |
| vg0318146978 | G -> A | LOC_Os03g31730-LOC_Os03g31740 | intergenic_region ; MODIFIER | silent_mutation | Average:68.602; most accessible tissue: Minghui63 young leaf, score: 79.896 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318146978 | NA | 4.96E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0318146978 | NA | 1.03E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 6.99E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 6.09E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 5.86E-08 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 8.48E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 7.92E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 8.68E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | 3.21E-06 | 2.42E-07 | mr1407 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 4.92E-06 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | 8.38E-06 | 5.30E-12 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 2.17E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 1.10E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | 6.65E-06 | 4.33E-12 | mr1735 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 1.31E-07 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 7.54E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 6.94E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 1.41E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 8.95E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 6.67E-06 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 5.83E-09 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 1.24E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318146978 | NA | 1.83E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |